Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ShRNA molecule for silencing human LINC01614 expression and application thereof

A technology of LINC01614 and SEQIDN0.2, applied in the field of silencing shRNA molecules expressed by human LINC01614, can solve the problems of rare literature reports, achieve the effects of reducing migration and invasion ability, inhibiting the expression of EMT molecules, and improving efficiency

Pending Publication Date: 2022-03-15
ZHEJIANG CHINESE MEDICAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be found in public databases that it is highly expressed in a variety of cancers, including breast cancer, non-small cell lung cancer, gastric cancer, glioma, etc., suggesting that it is closely related to the occurrence and development of tumors, but so far the literature on LINC01614 few reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ShRNA molecule for silencing human LINC01614 expression and application thereof
  • ShRNA molecule for silencing human LINC01614 expression and application thereof
  • ShRNA molecule for silencing human LINC01614 expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Obtaining of specific interfering sequence shRNA for silencing human LINC01614 expression

[0027] According to the website:

[0028] www.sigmaaldrich.cn / CN / zh / semi-configurators / shrna? activeLink=product Search Design the shRNA sequence and obtain the target gene sequence:

[0029] shRNA-1: TTCCTTAAAGTAGCAATCTTAGC (as shown in SEQ ID NO.1);

[0030] shRNA-2: GACAAGTTCAGTGGAAACTTTCT (as shown in SEQ ID No. 2).

[0031] The nucleotide sequence of the sense strand of shRNA-1 is:

[0032] 5'-CCGGTTCCTTAAAGTAGCAATCTTAGCCTCGAGGCTAAGATTGCTACTTTAAGGAATTTTTG-3' (as shown in SEQ ID NO.3);

[0033] The antisense strand nucleotide sequence of shRNA-1 is:

[0034] 5'-AATTCAAAAATTCCTTAAAGTAGCAATCTTAGCCTCGAGGCTAAGATTGCTACTTTAAGGAA-3' (shown in SEQ ID NO.4).

[0035] The positive-sense strand nucleotide sequence of shRNA-2 is:

[0036] 5'-CCGGGACAAGTTCAGTGGAAACTTTCTCTCGAGAGAAAGTTTCCACTGAACTTGTCTTTTTG-3' (as shown in SEQ ID N0.5);

[0037] The antisense strand nucleo...

Embodiment 2

[0044] Example 2: Construction of shRNA-lentiviral expression vector of LINC01614

[0045]The hU6-MCS-CBh-gcGFP-IRES-puromycin vector was linearized with EcoR I / Age I by double enzyme digestion, and the gel was cut and recovered; specific primers were designed according to shRNA to complete primer annealing; shRNA and enzyme digested recovered The homologous recombination of the linear vector forms a circular shape, which is transferred into the prepared bacterial competent cells, and the single clone colony is selected for sequencing and identification. The correct clone is the successfully constructed shRNA silencing vector.

[0046] Table 1: Design specific primers for shRNA

[0047]

[0048] Specific steps are as follows:

[0049] (1) The carrier is recovered by linear enzyme digestion, and the enzyme digestion system is shown in Table 2:

[0050] Table 2 enzyme digestion system

[0051]

[0052] After reacting for 1 hour at 37° C. (optimum temperature), perform 1...

Embodiment 3

[0062] Example 3: LINC01614-shRNA lentivirus transfection of human breast cancer cells

[0063] MDA-MB-231 and Hs578T cells were prepared in 2.5×10 5 Cells / well were seeded in 6-well plates, and when the cell density reached 70%, they were replaced with sh-LINC01614-1, sh-LINC01614-2, and sh-Control three kinds of lentivirus lysates (MOI=10) and infected with Add the reagents to the culture medium, shake and mix well and incubate for 8-10 hours, then replace it with a normal complete medium to continue the culture. After 72 hours, observe the expression of GFP green fluorescence with a fluorescence microscope. More than 90% of the transfection is successful.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a shRNA molecule for silencing human LINC01614 expression and application thereof, and belongs to the technical field of biomedicine. On one hand, the invention provides a target gene of the shRNA molecule for silencing human LINC01614 expression, and on the other hand, the shRNA molecule for silencing human LINC01614 expression and application of the shRNA molecule are provided. The obtained shRNA molecule can interfere with LINC01614 expression, so that the migration and invasion ability of tumor cells is reduced, EMT molecule expression is inhibited, and tumor formation and lung metastasis are inhibited in an in-vivo animal model. The invention provides a new scheme for targeted therapy of breast cancer.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to an shRNA molecule for silencing the expression of human LINC01614 and an application thereof. Background technique [0002] Breast cancer is a common malignant tumor, ranking first among female cancers because of its high incidence. In recent years, the incidence of female breast cancer in my country has been increasing year by year and gradually becoming younger. Although the discovery and development of anti-tumor treatment methods have improved the survival rate and quality of life of cancer patients to a certain extent, patients who receive tumor drug treatment usually have Obvious drug resistance leads to reduced curative effect, tumor recurrence, metastasis, and ultimately treatment failure. The invasion and metastasis of breast cancer is a multi-factor and multi-step complex process, which is regulated by the expression of various genes, and its specific mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A61K31/713A61P35/04A61P15/14
CPCC12N15/113A61P35/04A61P15/14C12N2310/10C12N2310/14C12N2320/32C12N2310/113C12N2310/531C12N15/86C12N2740/16043A61K31/7105C12Q1/6886C12Q2600/158C12Q2600/118C12Q2600/178C12N15/1135C12N2740/15043
Inventor 陶方方张志潜刘文洪徐烨刘青玲李俊峰
Owner ZHEJIANG CHINESE MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com