Salt-tolerant growth-promoting bradyrhizobium liaoning RY6 strain and application thereof
A technology of bradyrhizobium and bacterial strains, applied in the field of bradyrhizobium RY6 strains in Liaoning, to achieve the effects of increasing yield, promoting growth, and large application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] The acquisition and cultivation of embodiment 1 rhizobia RY6
[0038]On July 20, 2019, the present invention collected a peanut plant with a large number of nodules, large nodules and lush growth in the peanut planting field (E110.7511111 N19.76166667 H11.9) of Sanduo Village, Ruixi Township, Chengmai County, Hainan Province For root nodules, cut off the aboveground part of the peanut, put the whole root system together with the root nodules into a fresh-keeping bag, and store them in an ice pack at low temperature.
[0039] (1) Take out the root system of the peanut from the ice pack and rinse it under tap water for 2 to 3 times. After rinsing the root system, use scissors to cut off the fresh, complete, dark red root nodules with 2 mm in color, and put them in a petri dish with grade 2 water. Rinse the surface clean; this process ensures the integrity of the nodule surface.
[0040] (2) Transfer the rinsed root nodules to a sterilized petri dish, add 95% (volume rati...
Embodiment 2
[0060] The 16S rDNA sequence sequencing of embodiment 2 Rhizobium RY6 and the determination of category
[0061] In order to determine the phylogenetic status of Rhizobium RY6, the 16S rDNA series of the isolated strains were sequenced. Firstly, the DNA of the strain is extracted, and the primers are used for PCR-specific amplification.
[0062] Upstream primer 27F: 5-AGAGTTTGATCCTGGCTCAG-3;
[0063] Downstream primer 1492R: 5-CTACGGCTACCTTGTTACGA-3.
[0064] The PCR reaction conditions are as follows:
[0065] Primer: 35fc, 1492r
[0066] PCR amplification system:
[0067]
[0068] PCR amplification program:
[0069]
[0070] Get the amplification product 3mL on the 1.0% agarose gel electrophoresis test result such as Figure 4 As shown, the RY6 agarose gel electrophoresis band was sent to Shenzhen Weikemeng Technology Group Co., Ltd. for sequencing. The sequencing result is shown in SEQ ID NO 1:
[0071] ACCTACCGTGGCCGGCTGCCTCCCTTGCGGGTTAGCGCACCGTCTTCA GGTAAAACC...
Embodiment 3
[0073] Application experiment of embodiment 3 rhizobia RY6
[0074] In order to confirm the effect of RY6 on peanuts, the root nodule RY6 was reattached to the peanut root by the method of sand culture, and each treatment was repeated 4 times (for the treatment of bacteria, sand and seedlings, refer to the reintroduction experiment), and the root nodule was not inoculated as the control ( CK), and compare the connection. The whole process is irrigated with low-nitrogen nutrient solution. See table 2 and Figure 7 .
[0075] It can be seen from Table 2 that the whole plant fresh weight, peanut yield and root nodule number of peanuts after inoculation with Rhizobium RY6 were significantly increased compared with the control (CK).
[0076] Among all the physiological indicators of peanuts, the yield is the ultimate indicator to measure the high yield of peanuts. It can be seen from Table 2 that compared with the control, the yield of peanuts inoculated with Rhizobium RY6 incr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


