Unlock instant, AI-driven research and patent intelligence for your innovation.

Salt-tolerant growth-promoting bradyrhizobium liaoning RY6 strain and application thereof

A technology of bradyrhizobium and bacterial strains, applied in the field of bradyrhizobium RY6 strains in Liaoning, to achieve the effects of increasing yield, promoting growth, and large application prospects

Active Publication Date: 2022-04-15
TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, a Chinese patent discloses a bradyrhizobium strain DBPB1 suitable for stress-resistant nitrogen fixation in Northeast China. However, there is currently no rhizobia strain and bacterial agent suitable for southern peanut cultivation that has salt tolerance and can promote growth.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salt-tolerant growth-promoting bradyrhizobium liaoning RY6 strain and application thereof
  • Salt-tolerant growth-promoting bradyrhizobium liaoning RY6 strain and application thereof
  • Salt-tolerant growth-promoting bradyrhizobium liaoning RY6 strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The acquisition and cultivation of embodiment 1 rhizobia RY6

[0038]On July 20, 2019, the present invention collected a peanut plant with a large number of nodules, large nodules and lush growth in the peanut planting field (E110.7511111 N19.76166667 H11.9) of Sanduo Village, Ruixi Township, Chengmai County, Hainan Province For root nodules, cut off the aboveground part of the peanut, put the whole root system together with the root nodules into a fresh-keeping bag, and store them in an ice pack at low temperature.

[0039] (1) Take out the root system of the peanut from the ice pack and rinse it under tap water for 2 to 3 times. After rinsing the root system, use scissors to cut off the fresh, complete, dark red root nodules with 2 mm in color, and put them in a petri dish with grade 2 water. Rinse the surface clean; this process ensures the integrity of the nodule surface.

[0040] (2) Transfer the rinsed root nodules to a sterilized petri dish, add 95% (volume rati...

Embodiment 2

[0060] The 16S rDNA sequence sequencing of embodiment 2 Rhizobium RY6 and the determination of category

[0061] In order to determine the phylogenetic status of Rhizobium RY6, the 16S rDNA series of the isolated strains were sequenced. Firstly, the DNA of the strain is extracted, and the primers are used for PCR-specific amplification.

[0062] Upstream primer 27F: 5-AGAGTTTGATCCTGGCTCAG-3;

[0063] Downstream primer 1492R: 5-CTACGGCTACCTTGTTACGA-3.

[0064] The PCR reaction conditions are as follows:

[0065] Primer: 35fc, 1492r

[0066] PCR amplification system:

[0067]

[0068] PCR amplification program:

[0069]

[0070] Get the amplification product 3mL on the 1.0% agarose gel electrophoresis test result such as Figure 4 As shown, the RY6 agarose gel electrophoresis band was sent to Shenzhen Weikemeng Technology Group Co., Ltd. for sequencing. The sequencing result is shown in SEQ ID NO 1:

[0071] ACCTACCGTGGCCGGCTGCCTCCCTTGCGGGTTAGCGCACCGTCTTCA GGTAAAACC...

Embodiment 3

[0073] Application experiment of embodiment 3 rhizobia RY6

[0074] In order to confirm the effect of RY6 on peanuts, the root nodule RY6 was reattached to the peanut root by the method of sand culture, and each treatment was repeated 4 times (for the treatment of bacteria, sand and seedlings, refer to the reintroduction experiment), and the root nodule was not inoculated as the control ( CK), and compare the connection. The whole process is irrigated with low-nitrogen nutrient solution. See table 2 and Figure 7 .

[0075] It can be seen from Table 2 that the whole plant fresh weight, peanut yield and root nodule number of peanuts after inoculation with Rhizobium RY6 were significantly increased compared with the control (CK).

[0076] Among all the physiological indicators of peanuts, the yield is the ultimate indicator to measure the high yield of peanuts. It can be seen from Table 2 that compared with the control, the yield of peanuts inoculated with Rhizobium RY6 incr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a salt-tolerant growth-promoting bradyrhizobium liaoningense RY6 strain and application of the salt-tolerant growth-promoting bradyrhizobium liaoningense RY6 strain, the strain is preserved in the China Center for Type Culture Collection on April 28, 2021, and the preservation number is CCTCC NO: M 2021478. The RY6 strain has relatively strong salt tolerance, is an efficient matched strain of peanuts, can enable the peanuts to efficiently nodulate and achieve the characteristic of high yield after being inoculated, can remarkably improve the yield of the peanuts by 86.03% or above when being inoculated with the rhizobium in comparison with a non-inoculation manner, can be widely applied to soil in the south of China, can enable the peanuts to achieve high yield, and has good economic benefits and social benefits. And the method has a relatively great application prospect.

Description

technical field [0001] The invention relates to the technical field of functional microorganisms, and more specifically relates to a Bradyrhizobium liaoningensis RY6 strain suitable for peanut planting in southern China, which has salt tolerance and can efficiently nodulate peanuts and promote growth, and its application. Background technique [0002] Nitrogen is one of the most important nutrients for plant growth. Nitrogen in soil is mainly composed of nitrogen decomposed from soil minerals, nitrogen fixed by soil microorganisms and nitrogen applied by chemical fertilizers. The application of nitrogen fertilizer in agricultural production is an important means to ensure high yield, but blindly applying a large amount of nitrogen fertilizer makes the content of chemical fertilizer in the soil greatly exceed the needs of soil storage and crop absorption, resulting in a decrease in the utilization rate of chemical fertilizer, and at the same time causing soil compaction and en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01C1/06A01G7/06A01G22/40C12R1/41
CPCY02P60/21
Inventor 张洁董荣书刘国道刘攀道陈志坚李欣勇黄睿
Owner TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI