Method for detecting H7 subtype avian influenza virus without amplification based on Cas13a
A bird flu virus, real-time detection technology, applied in the direction of biochemical equipment and methods, measuring devices, microbial measurement/inspection, etc., can solve the problems of increasing detection time and cost, and achieve the effect of shortening the reaction time and easy operation of the method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The instruments and reagents used in this embodiment are as follows:
[0028] instrument:
[0029] Bio-Rad real-time fluorescent quantitative PCR instrument (Chromo4 Real-Time PCR Detector).
[0030] Reagent:
[0031] CRISPR-Cas13a (Lwa) gene editing protein, fluorescent double-labeled probe for Cas13a detection system, H7 template ssRNA and H7-specific crRNA, viral genomic DNA / RNA extraction kit.
[0032] Wherein, the H7-specific crRNA nucleic acid sequence is:
[0033] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCAUCACACUUGUGAAAUAUUUCAAAGCA.
[0034] Reaction buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 1.5mM MgCl 2 .
[0035] The method for directly detecting H7 subtype avian influenza virus without amplification based on CRISPR-Cas13a comprises the following steps:
[0036] (1) Extract sample RNA
[0037] Use the Viral Genomic DNA / RNA Extraction Kit to extract the viral genomic RNA in the sample according to the procedure, and directly detect it, or store it at -80 degr...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap