Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HLA-F modified cells and methods

A technology of HLA-F and HLA-G, which is applied in the direction of genetically modified cells, chemical instruments and methods, biochemical equipment and methods, etc., can solve the problems of time-consuming and high cost

Pending Publication Date: 2022-07-12
APPL STEMCELL INC
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Such personalized cell therapy is not only costly ($475,000 per treatment for Kymriah, $373,000 per treatment for Yescarta) but also time-consuming, which in some cases could be a matter of life and death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HLA-F modified cells and methods
  • HLA-F modified cells and methods
  • HLA-F modified cells and methods

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] This example illustrates the expression levels of HLA-F in iPS (iPSC 9211) and HEK-293 cells with or without transfection of exogenous nucleic acid.

[0128] To measure the mRNA levels of HLA-E, HLA-F and HLA-G in cells, total RNA was extracted from cells using the Quick-RNA Microprep kit (Zymo Research). cDNA was prepared from total RNA extracts using the iScript cDNA synthesis kit (Bio-Rad). HLA-E, F and G levels were determined by real-time PCR using go-Tag green polymerase (Promega) and the following primers.

[0129] Table 1: Primers used to detect HLA-E, F and G

[0130] primer sequence SEQ ID NO HuHLA-E-F TTCGCCTACGACGGCAAGGA 32 HuHLA-E-R CCCTTCTCCAGGTATTTGTG 33 HuHLA-F-F GGCAGAGGAATATGCAGAGGAGTT 34 HuHLA-F-R CTTCTGTGTCCTGGGTCTGTTC 35 HuHLA-G-F TTGGGAAGAGGAGACACGGAACA 36 HuHLA-G-R AGGTCGCAGCCAATCATCCAC 37 XC423-HLA-G-F-1 GAGCGAGGCCAGTGAGTAA 38 XC424-HLA-G-R-1 TCTCCCAGGTAGAGGGTCTG 39 ...

Embodiment 2

[0135] This example illustrates HLA-F expression in modified and unmodified HEK293 cells.

[0136] The inventors have previously made TARGATT TM HEK293 cells are ready for gene insertion (see Figure 7 ). Use TARGATT TM HEK293 cells, the inventors generated modified HEK293 cells comprising a single copy insertion of HLA-F or HLA-G at the H11 locus of the safe harbor genome. The same qRT-PCR was performed to measure mRNA expression. The data in Table 3 demonstrate that HEK293 cells have higher basal levels of HLA expression compared to iPS cells, with more HLA-F and G expressed in HEK293 compared to HLA-E. One copy of exogenous HLA-F and HLA-G increased HLA-F and HLA-G expression 10-fold and 7-fold, respectively.

[0137] Table 3: Expression of HLA-E, F and G in modified or unmodified HEK293 cells. For comparison purposes, iPSCs were included in the same experiment.

[0138]

[0139]

Embodiment 3

[0141] This example illustrates the expression of HLA-F variants in HEK293 cells.

[0142] Naturally occurring HLA-F contains from N-terminal to C-terminal: HLA-Fα1 domain, α2 domain, α3 domain, transmembrane domain and cytoplasmic domain. The HLA-Fα1 domain and the α2 domain form the peptide binding groove. The HLA-Fα3 domain binds to β-2 globulin (β2M), which is required for the stability of the HLA-F complex.

[0143] In addition to the "canonical" isoform 1 (SEQ ID NO: 1 or 2), which has 346 amino acids (the short form of HLA-F in Table 4, referred to as "HLA-F-S"), HLA-F exists in various subtypes, mainly subtype 3, which is the longest subtype with an additional 96 amino acid sequence in its cytoplasmic region (for the HLA-F long form, referred to as "HLA-F-L", SEQ ID NO: 3 or 4).

[0144] The inventors have produced an HLA-F-β2M fusion protein ( Figure 5 C and Figure 5 D), which contains a signal peptide, α1, 2 and 3 domains, 15 amino acids (GGGGS) from N-termina...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure provides compositions and methods for cell transplantation therapy based on the forced expression of an exogenous HLA-F protein in donor cells to be transplanted into a subject. In some embodiments, a donor cell expresses an exogenous chimeric HLA-F protein comprising an extracellular region comprising an HLA-F [alpha] 1 domain, an HLA-F [alpha] 2 domain, an HLA-F [alpha] 3 domain, a linker, and a [beta] 2m protein.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS [0002] This application claims priority to US Provisional Patent Application No. 63 / 069,141, dated Aug. 23, 2020, the disclosure of which is incorporated herein by reference. [0003] Field of Invention [0004] The present disclosure generally relates to cell biology, immunology, and cell transplantation therapy. In particular, the present disclosure relates to compositions and methods for cell transplantation therapy based on the enforced expression of exogenous HLA-F proteins or variants thereof in donor cells to be transplanted into a subject. Background technique [0005] Cell transplantation therapy is a procedure in which a patient receives donor cells to replace damaged cells or to maintain biological function through donor cells. One of the main risks of cell transplantation therapy is rejection of the transplanted cells by the recipient's immune system, especially when the donor cells are from a foreign host. To re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61P37/06C12N15/90A61K39/00A61K38/17A61K35/15C07K14/74
CPCA61P37/06C07K14/70539A61K48/005A01K2267/0331A01K2227/105A01K2207/12C12N2510/00C12N5/0696C12N5/0646C12N2506/45C07K2319/03C07K2319/00A61K39/4631A61K2239/31A61K39/4613A61K2239/38A61K39/464412A61K35/17C07K14/70575C07K16/2896C12N5/0606G01N33/5014
Inventor R·雁如·蔡A·法鲁吉奥迟秀玲王凯
Owner APPL STEMCELL INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com