PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance
A carrier, pegfp-c2 technology, applied in the field of medical molecular biology, can solve the problems of unable to screen out cells, not carrying eukaryotic cells, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Construction of RNAi vectors with green fluorescent protein tracer and resistance screening markers;
[0028] 1. Cloning of human small nuclear RNA (U6) promoter
[0029] 1. Preparation of 293 cell genomic DNA
[0030]293 cells (purchased from ATCC) were routinely cultured in DMEM medium containing 10% fetal bovine serum (purchased from Gibico), and centrifuged to collect 1×10 7 Genomic DNA was isolated from cells using proteinase K and phenol (see Molecular Cloning Experiment Guide for specific operations).
[0031] 2. Design of synthetic primers
[0032] Upstream primer 5'-CCGACGCGTAGATCTAAGGTCGGGCAGGAAGAG-3', downstream primer 5'-CCGACGCGTCTCGAGGAATTCGGATCCGTCGACAAAAAGAAGACCACGGTGTTTCGTCCTTTC-3' (2OD, synthesized by Shanghai Shenneng Group Co., Ltd.), MluI and BglII restriction sites were introduced into the upstream primer in sequence, MluI, XholI were introduced into the downstream primer in sequence , EcoRI, BamHI, SalI and BbsI restriction sites. P...
Embodiment 2
[0042] Example 2: RNA interference against tumor-associated gene β-catenin
[0043] 1. Selection of RNA interference fragments
[0044] β-catenin is an effector molecule of Wnt pathway, and abnormal activation of this pathway is closely related to the occurrence of many tumors. Based on our experience in the literature, we have http: / / www.ambion.com / techlib / misc / sirna_fi nder.html , the siRNA fragment was designed according to the β-catenin gene, the nucleotide sequence is as follows:
[0045] 5'- TCCTGTATGAGTGGGAACG GGTTCCCACTCATACAGGACTTTTTTT-3'
[0046] 3’-AGGACATACTCACCCTTGC CCAAGGGTGAGTATGTCCTGAAAAAA -5' where the antisense sequence is in the front, the sense sequence is in the back, and the two ends have sticky ends with BbsI (ACCG) and BamHI (GATC) restriction sites respectively, and a HindIII enzyme is contained in the loop structure connecting the two sequences cutting site (AAGCTT) for use in identification.
[0047] 2. In vitro annealing method of RNA...
Embodiment 3
[0053] Example 3: RNA interference against luciferase reporter gene (Luciferase)
[0054] 1. Selection of RNA interference fragments
[0055] The interference target sequence for the luciferase reporter gene is designed according to the known effective fragments used in the literature (Genes & Development 16, 948-958; 2002):
[0056] 5'- GATTCCAATTCAGCGGGAGCCACCTGATG GATCGGGTGGCTCTCGCTGAGTTGGAATCCTTTTTT-3'
[0057] 3'-CTAAGGTTAAGTCGCCCTCGGTGGACTAC CTAGCCCACCGAGAGCGACTCAACCTTAGGAAAAAA -The 5'antisense sequence is in the front, the sense sequence is in the back, and the two ends have sticky ends with BbsI (ACCG) and BamHI (GATC) restriction sites respectively, and the loop structure connecting the two sequences contains a HindIII restriction enzyme site (AAGCTT) for use in identification.
[0058] 2. The in vitro annealing method of RNA interference fragments (the specific operation is the same as before)
[0059] The vector was double-enzymatically digested with BbsI...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 