Unlock instant, AI-driven research and patent intelligence for your innovation.

PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance

A carrier, pegfp-c2 technology, applied in the field of medical molecular biology, can solve the problems of unable to screen out cells, not carrying eukaryotic cells, etc.

Inactive Publication Date: 2006-02-15
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since these vectors do not carry eukaryotic cell resistance selection markers, cells that stably integrate RNAi vectors on the genome cannot be selected, so the inhibition of target gene expression can only be observed in a short period of time (5-7 days) and cannot be used. its eternal silence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance
  • PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance
  • PGO of RNA1 carrier possessing labelling of green fluorescence protein and screening tag of resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Construction of RNAi vectors with green fluorescent protein tracer and resistance screening markers;

[0028] 1. Cloning of human small nuclear RNA (U6) promoter

[0029] 1. Preparation of 293 cell genomic DNA

[0030]293 cells (purchased from ATCC) were routinely cultured in DMEM medium containing 10% fetal bovine serum (purchased from Gibico), and centrifuged to collect 1×10 7 Genomic DNA was isolated from cells using proteinase K and phenol (see Molecular Cloning Experiment Guide for specific operations).

[0031] 2. Design of synthetic primers

[0032] Upstream primer 5'-CCGACGCGTAGATCTAAGGTCGGGCAGGAAGAG-3', downstream primer 5'-CCGACGCGTCTCGAGGAATTCGGATCCGTCGACAAAAAGAAGACCACGGTGTTTCGTCCTTTC-3' (2OD, synthesized by Shanghai Shenneng Group Co., Ltd.), MluI and BglII restriction sites were introduced into the upstream primer in sequence, MluI, XholI were introduced into the downstream primer in sequence , EcoRI, BamHI, SalI and BbsI restriction sites. P...

Embodiment 2

[0042] Example 2: RNA interference against tumor-associated gene β-catenin

[0043] 1. Selection of RNA interference fragments

[0044] β-catenin is an effector molecule of Wnt pathway, and abnormal activation of this pathway is closely related to the occurrence of many tumors. Based on our experience in the literature, we have http: / / www.ambion.com / techlib / misc / sirna_fi nder.html , the siRNA fragment was designed according to the β-catenin gene, the nucleotide sequence is as follows:

[0045] 5'- TCCTGTATGAGTGGGAACG GGTTCCCACTCATACAGGACTTTTTTT-3'

[0046] 3’-AGGACATACTCACCCTTGC CCAAGGGTGAGTATGTCCTGAAAAAA -5' where the antisense sequence is in the front, the sense sequence is in the back, and the two ends have sticky ends with BbsI (ACCG) and BamHI (GATC) restriction sites respectively, and a HindIII enzyme is contained in the loop structure connecting the two sequences cutting site (AAGCTT) for use in identification.

[0047] 2. In vitro annealing method of RNA...

Embodiment 3

[0053] Example 3: RNA interference against luciferase reporter gene (Luciferase)

[0054] 1. Selection of RNA interference fragments

[0055] The interference target sequence for the luciferase reporter gene is designed according to the known effective fragments used in the literature (Genes & Development 16, 948-958; 2002):

[0056] 5'- GATTCCAATTCAGCGGGAGCCACCTGATG GATCGGGTGGCTCTCGCTGAGTTGGAATCCTTTTTT-3'

[0057] 3'-CTAAGGTTAAGTCGCCCTCGGTGGACTAC CTAGCCCACCGAGAGCGACTCAACCTTAGGAAAAAA -The 5'antisense sequence is in the front, the sense sequence is in the back, and the two ends have sticky ends with BbsI (ACCG) and BamHI (GATC) restriction sites respectively, and the loop structure connecting the two sequences contains a HindIII restriction enzyme site (AAGCTT) for use in identification.

[0058] 2. The in vitro annealing method of RNA interference fragments (the specific operation is the same as before)

[0059] The vector was double-enzymatically digested with BbsI...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A RANi carrier pGO with green fluorescin tracing and eukaryocyte resistance screening marker is prepared through reforming pEGFP-C2 carrier in such manner that original polyclonal site is removed and the promote U6 with relative polyclonal site is inserted between SV40 polyA and fl prokary otic duplication beginning point. It can be used for developing anticancer medicine.

Description

technical field [0001] The invention relates to the technical field of medical molecular biology, and is an RNA interference (RNAi) carrier pGO with green fluorescent protein tracing and resistance screening markers, which can be used to specifically inhibit the expression of target genes. Background technique [0002] RNA interference (RNAi) refers to the phenomenon that double-stranded RNA (dsRNA) specifically induces the degradation of mRNA molecules with its homologous sequences, resulting in the inhibition of corresponding gene expression. It is a special post-transcriptional gene expression silencing phenomenon. The phenomenon of RNA interference (RNAi) was first discovered and reported in nematodes by Fire et al. in 1998. They observed that double-stranded RNA (dsRNA) can specifically repress gene expression at the post-transcriptional level in C. elegans. Subsequently, many scholars conducted a large number of studies on nematodes, fruit flies...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/63C12N15/79A61K48/00A61P35/00
Inventor 王红阳鄢和新张瑞陈磊吴孟超
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY