Construction of EP153R and EP402R gene co-expression recombinant adenovirus vector and adenovirus packaging method

A technology of EP402R and EP153R, applied in the direction of virus/phage, microorganism-based method, vector, etc., can solve the problem of no EP153R recombinant adenovirus vector, etc.

Inactive Publication Date: 2019-04-19
YANGZHOU UNIV
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no recombinant adenoviral vector for co-expression of EP153R and EP402R genes in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of EP153R and EP402R gene co-expression recombinant adenovirus vector and adenovirus packaging method
  • Construction of EP153R and EP402R gene co-expression recombinant adenovirus vector and adenovirus packaging method
  • Construction of EP153R and EP402R gene co-expression recombinant adenovirus vector and adenovirus packaging method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] i. Optimized synthesis of the gene in Example 1

[0038] EP153R gene synthesis: query the EP153R gene (NC_001659.2), EP402R gene (NC_001659.2) and CTLA4 gene (NC_010457.5) from pig cell lines included in the NCBI website, and obtain optimized (referring to nucleoside optimized acid sequence), the sequence is as SEQ ID No.1-3.

[0039] CTLA4 sequence Seq ID No.1

[0040] GCTAGAGATCTGGTACCGCCACCATGCACGTGGCCCAACCTGCAGTAGTGCTGGCCAACAGCCGGGGTGTTGCCAGCTTTGTGTGTGAGTATGGGTCTGCAGGCAAAGCTGCCGAGGTCCGGGTGACAGTGCTGCGGCGGGCCGGCAGCCAGATGACTGAAGTCTGTGCCGCGACATATACTGTGGAGGATGAGTTGACCTTCCTTGATGACTCTACATGCACTGGCACCTCCACCGAAAACAAAGTGAACCTCACCATCCAAGGGCTGAGAGCCGTGGACACTGGGCTCTACATCTGCAAGGTGGAGCTCCTGTACCCACCACCCTACTATGTGGGTATGGGCAACGGGACCCAGATTTATGTCATTGATCCAGAACCATGCCCAGATTCTGATAGTACTGATTACAAAGACGATGACGATAAG

[0041] EP153R sequence Seq ID No.2

[0042] AAAGACGATGACGATAAGACCGGTTTCAGCAACAAGAAGTACATCGGCCTGATCAACAAGAAGGAGGGCCTGAAGAAGAAGATCGATGACTACAGCATCCTGATCATCGGCATCCTGATCGGCACCAACATCCTGAG...

Embodiment 3

[0063] iii. Example 3 Restriction digestion and homologous recombination of pShuttle-CMV vector

[0064]1) Digest the pShuttle-CMV vector, and the restriction system is shown in Table 3.

[0065] Table 3 enzyme digestion system

[0066] Reaction solution composition

volume

Plasmid (350ng / μL)

20 μL

10×Buffer

5μL

KpnI

2μL

Hind III

2μL

ddH2O

31μL

total

50μL

[0067] After adding the sample and mixing it, place it at 37°C for enzyme digestion for 6 hours. After the reaction, use 1% agarose gel electrophoresis to detect the size of the digested band, and use a gel recovery kit to recover the linearized plasmid.

[0068] 2) Vector and fragment homologous recombination:

[0069] Table 4 Reaction system for homologous recombination of vectors and fragments

[0070] Reaction solution composition

volume

pShuttle-CMV (90ng / μL)

2μL

CTLA4-EP153 (50ng / μL)

1.5μL

EP...

Embodiment 4

[0076] iv. Example 4 Transient expression of 293T cells and its verification

[0077] 1) 293T cell transfection

[0078] Cell preparation: 1 x 10 6 293T cells were evenly spread in each well of a 6-well plate, and used for cell transfection after the cells adhered to the wall the next day;

[0079] Plasmid preparation: Mix 2.5 μg pShuttle-CMV-CTLA4-EP153R-EP402R plasmid with 7.5 μL Lip3000 liposomes and 500 μL serum-free DMEM medium, let stand for 4 minutes, mix the plasmid mixture with Lip3000 mixture, let stand 10min;

[0080] The mixture was added dropwise to the culture medium, shaken gently, and cultured at 37°C.

[0081] Cells were collected after 24 h.

[0082] 2) WB detection of protein expression

[0083] Protein extraction: wash twice with PBS, add 250μl cell lysate (containing protease inhibitors and protein phosphatase inhibitors), digest and blow off the cells, shake and mix, ice bath for 25min, centrifuge at 12000rpm for 15min, absorb 200μl supernatant and a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides construction of an EP153R and EP402R gene co-expression recombinant adenovirus vector and a adenovirus packaging method, and belongs to the technical field of genetic engineering. Based on a pShuttle-CMV eukaryotic expression vector, an EP153R gene and EP402R gene overexpression adenovirus vector pAD-Shuttle-CMV-CTLA4-EP153R-EP402R is introduced with CTLA4, EP153R and EP402Rgenes at multiple cloning sites. The invention also provides recombinant adenovirus for co-expressing EP153R and EP402R genes, and the adenovirus packaging process is achieved by utilizing the constructed pAD-Shuttle-CMV-CTLA4-EP153R-EP402R vector to obtain the adenovirus capable of directly infecting animal or eukaryotic cells, thereby achieving the purpose of co-expressing EP153R and EP402R genes in eukaryotic cells, and laying a foundation for researching the adenovirus vaccine for achieving the co-expression of EP153R and EP402R genes.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant adenovirus vector for co-expression of African swine fever virus EP153R and EP402R genes, a construction method and an adenovirus packaging method. Background technique [0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African swine fever virus (ASFV). It is characterized by short course of disease, high fatality rate, clinical symptoms and pathological changes similar to acute swine fever, manifested as high fever, skin congestion, abortion, edema and organ hemorrhage. ASFV is an icosahedral virus with a diameter of 200nm. The virus contains a DNA core with a diameter of 70-100nm, surrounded by a capsid with a diameter of 172-191nm and a lipid-containing capsule. The ASFV genome is a single-molecule linear double-stranded DNA whose ends are covalently closed, with a size of 170-190 kb (vari...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/34C12N15/12C12N7/01A61K39/12A61P31/20C12R1/93
CPCA61P31/20C12N7/00C12N15/86C07K14/005C07K14/70521C12N2710/10343C12N2710/12034C12N2710/12022C12N2800/107A61K39/00
Inventor张泉朱立麒谢灵志郭晓宇朱鸿飞
OwnerYANGZHOU UNIV