Hybrid antibacterial protein with strong bactericidal effect and application thereof
A bactericidal effect, antibacterial protein technology, applied in the direction of medical preparations with no active ingredients, medical preparations containing active ingredients, hybrid peptides, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Construction, expression and purification of engineering bacteria of embodiment 1, AB469
[0039] 1. Construction of engineering bacteria of AB469
[0040] According to the codon preference of Escherichia coli, the nucleic acid sequence (SEQ ID NO: 2) capable of encoding AB469 was artificially designed and synthesized, namely ab469; an NcoI restriction endonuclease site (italic part) was added to its 5' end, and at the same time The nucleic acid sequence ct is introduced more, together with the g at the end of the restriction site, a codon encoding an alanine is formed; a HindIII restriction endonuclease site (italic part) is added at the 3' end. The sequence is as follows:
[0041] ccatgg ctatcctgaccaaagatggctttggcatcattcgcaacgaactgtttggcggcaaactggatcagacacaggtggatg ccattaattttattgttgaaaaagctaccgaatctgggttaagttatccggaagcggcctatctgttagcgacgatctatcatgaaacgggt ctgccgagcggttatcgtaccatgcagccaatcaaagaagccggtagtgataattacctccgctctaaaaaatattatccgtatatcggct atggctatgttcagctga...
Embodiment 2、AB469
[0046] Construction, expression and purification of engineering bacteria of embodiment 2, AB469 mutants AB46M9, AB469M and B946
[0047] 1. Construction of mutant engineering bacteria
[0048] Mutant AB46M9 (SEQ ID NO: 3) is composed of a catalytic domain AB46M (SEQ ID NO: 10) and a binding domain SP10 (154- 236aa) (SEQ ID NO:11), with a flexible Linker in the middle.
[0049] The mutant AB469M (SEQ ID NO: 5) is composed of the catalytic domain AB46 (1-185aa) and the binding domain B9M (SEQ ID NO: 12) which has 82% similarity to the amino acid sequence of SP10 (154-236 aa), and the middle is A flexible Linker.
[0050] B946 (SEQ ID NO:7) is composed of the binding domain SP10 (154-236aa) and the catalytic domain AB46 (1-185aa), with a flexible Linker in the middle, and the positions of the catalytic domain and the binding domain are just opposite to those of AB469.
[0051] According to the codon preference of Escherichia coli, the nucleic acid sequences ab46m9 (SEQ ID NO 4...
Embodiment 3
[0053] Embodiment 3, turbidimetric method detects the bactericidal activity of AB469 to Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae
[0054] The overnight cultured Acinetobacter baumannii (ATCC 19606), Pseudomonas aeruginosa (ATCC 15442), and Klebsiella pneumoniae (ATCC 700603) were grown to mid-log phase (OD 600 About 0.5), centrifuge (5,000g, 5 minutes) to collect the bacteria. The cells were washed twice with 20mm PBS (pH 7.2), and then resuspended in PBS buffers containing different NaCl concentrations (0-600 mM). Add sample (final concentration 2 μg / mL) or PBS control, 10 μl 200 mm EDTA (final concentration 0.5 mm) and 50 μl bacterial suspension in 96-well plate, add PBS to total reaction system 200 μl, reaction temperature 37 ° C, in Read at a wavelength of 600nm (1 minute interval, 10 readings).
[0055] Turbidity test results see Figure 2-Figure 4 , AB469 can cause the OD value of the bacterial liquid to decrease by lysing the pathogenic ba...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com