Hybrid antibacterial protein with strong bactericidal effect and application thereof

A bactericidal effect, antibacterial protein technology, applied in the direction of medical preparations with no active ingredients, medical preparations containing active ingredients, hybrid peptides, etc.

Active Publication Date: 2021-04-30
JIANGXI YUANSHENG BIOLOGICAL TECH CO LTD
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antibacterial proteins entering the clinic are all focused on the treatment of G + bacterial infections, there is currently no treatment for Gram-negative bacteria (G - Bacteria) antibacterial protein into clinical research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hybrid antibacterial protein with strong bactericidal effect and application thereof
  • Hybrid antibacterial protein with strong bactericidal effect and application thereof
  • Hybrid antibacterial protein with strong bactericidal effect and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Construction, expression and purification of engineering bacteria of embodiment 1, AB469

[0039] 1. Construction of engineering bacteria of AB469

[0040] According to the codon preference of Escherichia coli, the nucleic acid sequence (SEQ ID NO: 2) capable of encoding AB469 was artificially designed and synthesized, namely ab469; an NcoI restriction endonuclease site (italic part) was added to its 5' end, and at the same time The nucleic acid sequence ct is introduced more, together with the g at the end of the restriction site, a codon encoding an alanine is formed; a HindIII restriction endonuclease site (italic part) is added at the 3' end. The sequence is as follows:

[0041] ccatgg ctatcctgaccaaagatggctttggcatcattcgcaacgaactgtttggcggcaaactggatcagacacaggtggatg ccattaattttattgttgaaaaagctaccgaatctgggttaagttatccggaagcggcctatctgttagcgacgatctatcatgaaacgggt ctgccgagcggttatcgtaccatgcagccaatcaaagaagccggtagtgataattacctccgctctaaaaaatattatccgtatatcggct atggctatgttcagctga...

Embodiment 2、AB469

[0046] Construction, expression and purification of engineering bacteria of embodiment 2, AB469 mutants AB46M9, AB469M and B946

[0047] 1. Construction of mutant engineering bacteria

[0048] Mutant AB46M9 (SEQ ID NO: 3) is composed of a catalytic domain AB46M (SEQ ID NO: 10) and a binding domain SP10 (154- 236aa) (SEQ ID NO:11), with a flexible Linker in the middle.

[0049] The mutant AB469M (SEQ ID NO: 5) is composed of the catalytic domain AB46 (1-185aa) and the binding domain B9M (SEQ ID NO: 12) which has 82% similarity to the amino acid sequence of SP10 (154-236 aa), and the middle is A flexible Linker.

[0050] B946 (SEQ ID NO:7) is composed of the binding domain SP10 (154-236aa) and the catalytic domain AB46 (1-185aa), with a flexible Linker in the middle, and the positions of the catalytic domain and the binding domain are just opposite to those of AB469.

[0051] According to the codon preference of Escherichia coli, the nucleic acid sequences ab46m9 (SEQ ID NO 4...

Embodiment 3

[0053] Embodiment 3, turbidimetric method detects the bactericidal activity of AB469 to Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae

[0054] The overnight cultured Acinetobacter baumannii (ATCC 19606), Pseudomonas aeruginosa (ATCC 15442), and Klebsiella pneumoniae (ATCC 700603) were grown to mid-log phase (OD 600 About 0.5), centrifuge (5,000g, 5 minutes) to collect the bacteria. The cells were washed twice with 20mm PBS (pH 7.2), and then resuspended in PBS buffers containing different NaCl concentrations (0-600 mM). Add sample (final concentration 2 μg / mL) or PBS control, 10 μl 200 mm EDTA (final concentration 0.5 mm) and 50 μl bacterial suspension in 96-well plate, add PBS to total reaction system 200 μl, reaction temperature 37 ° C, in Read at a wavelength of 600nm (1 minute interval, 10 readings).

[0055] Turbidity test results see Figure 2-Figure 4 , AB469 can cause the OD value of the bacterial liquid to decrease by lysing the pathogenic ba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a heterozygous antibacterial protein with strong bactericidal effect and an application thereof, the heterozygous antibacterial protein with strong bactericidal effect comprises an amino acid sequence as shown in SEQ ID NO 1, and is named as AB469, a heterozygous protein composed of the sequences similar to the catalytic domain of the AB469, a heterozygous protein composed of the sequences similar to the binding domain of the AB469 or a heterozygous protein composed of the catalytic domain and the binding domain of the AB469 through position exchange. The heterozygous antibacterial protein disclosed by the invention is expressed by utilizing escherichia coli or saccharomycetes and the like, and high-purity hybrid antibacterial protein is obtained after purification; the protein can rapidly split gram-negative bacteria such as acinetobacter baumannii, pseudomonas aeruginosa, klebsiella pneumoniae, salmonella and escherichia coli. An antibacterial preparation prepared from the antibacterial protein can be used for preventing and treating bacterial infection, and can be prepared into an antibacterial preparation for preventing and treating bacterial infection, sterilizing medical instruments and medical places and the like.

Description

technical field [0001] The present invention relates to hybrid antimicrobial proteins. [0002] technical background [0003] Antibiotics have been widely used in the fields of medical care and agriculture, and have played an important role in the treatment of infectious diseases and the protection of public health. However, with the extensive use of antibiotics, the problem of bacterial resistance to antibiotics is becoming more and more serious, which has caused difficulties in clinical treatment and increased mortality worldwide, seriously threatening human health. [0004] Multidrug-resistant bacteria mainly include Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter, Enterococcus and Staphylococcus aureus, among which Gram-negative bacteria (G - Baumannii bacteria) accounted for the largest proportion, especially the drug resistance of Acinetobacter baumannii has become more and more serious in recent years (Mezzatesta M L, D'Andrea M M, Migliavacca R, et al. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00A61K38/16A61P31/04
CPCC07K14/00A61P31/04A61K38/00C07K2319/00C07K14/005C12N2795/10022C12N2795/10032C12Y302/01017C12N9/2462Y02A50/30
Inventor陆海荣黄青山李国栋黄晋江赵晓蔚陆婉英
OwnerJIANGXI YUANSHENG BIOLOGICAL TECH CO LTD