Method for establishing recombinant adenovirus vector with Africa swine fever EP153R and P54 gene coexpression and packaging adenovirus

A technology of EP153R, African swine fever virus, applied in the direction of virus/phage, antiviral agent, genetic engineering, etc.

Pending Publication Date: 2019-05-10
YANGZHOU UNIV
View PDF6 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no recombinant adenovirus vector for co-expression of CTLA4, EP153R, and P54 genes in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing recombinant adenovirus vector with Africa swine fever EP153R and P54 gene coexpression and packaging adenovirus
  • Method for establishing recombinant adenovirus vector with Africa swine fever EP153R and P54 gene coexpression and packaging adenovirus
  • Method for establishing recombinant adenovirus vector with Africa swine fever EP153R and P54 gene coexpression and packaging adenovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The optimized synthesis of embodiment 1 gene

[0039] Query the EP153R gene (GI: 22220439), P54 gene (GI: 290782550) and the CTLA4 gene (NC_010457.5) from the porcine cell line included in the NCBI website, and obtain optimization (referring to optimizing the nucleotide sequence) through artificial synthesis ) after the gene, the sequence is as SEQ ID No.1-3.

[0040] CTLA4 sequence Seq ID No.1

[0041] GCTAGAGATCTGGTACCGCCACCATGCACGTGGCCCAACCTGCAGTA GTGCTGGCCAACAGCCGGGGTGTTGCCAGCTTTGTGTGTGAGTATGGGTC TGCAGGCAAAGCTGCCGAGGTCCGGGTGACAGTGCTGCGGCGGGCCGGC AGCCAGATGACTGAAGTCTGTGCCGCGACATATACTGTGGAGGATGAGTT GACCTTCCTTGATGACTCTACATGCACTGGCACCTCCACCGAAAACAAAG TGAACCTCACCATCCAAGGGCTGAGAGCCGTGGACACTGGGCTCTACATC TGCAAGGTGGAGCTCCTGTACCCACCACCCTACTATGTGGGTATGGGCAA CGGGACCCAGATTTATGTCATTGATCCAGAACCATGCCCAGATTCTGATA GTACTGATTACAAAGACGATGACGATAAG

[0042] EP153R sequence Seq ID No.2

[0043] AAAGACGATGACGATAAGACCGGTTTCAGCAACAAGAAGTACATCG GCCTGATCAACAAGAAGGAGGGCCTGAAGAAGAAGATCGATGACTACA...

Embodiment 2

[0046] Modification and amplification of fragments of embodiment 2

[0047] 1) Primer design, see Table 1:

[0048] Table 1 Primer design

[0049]

[0050] 2) CTLA4, EP153R, P54 fragment PCR

[0051] CTLA4: CTLA4-KpnI-F+CTLA4-R+CTLA4-Flag-R

[0052] EP153R: EP153R-Flag-F+EP153R-Myc-R

[0053] P54: P54-Myc-F+P54-HA-R+HA-R

[0054] CTLA4-EP153R-P54: CTLA4-KpnI-F+EP153R-Myc-R+HA-R (template is CTLA4+EP153R+P54)

[0055] That is, when amplifying the CTLA4 gene (PCR product 1), the primer combination of CTLA4-KpnI-F+CTLA4-R+CTLA4-Flag-R is used, and the DNA template is Seq ID No.1; when amplifying the EP153R gene (PCR product 2) The primer combination of EP153R-Flag-F+EP153R-Myc-R is used, and the DNA template is Seq ID No.2; when amplifying P54 (PCR product 3), the primer combination of P54-Myc-F+P54-HA-R+HA-R is used Primer combination, DNA template is Seq ID No.3. When amplifying CTLA4-EP153R-P54 (PCR product 4), the primer combination of CTLA4-KpnI-F+EP153R-Myc-R+HA-R...

Embodiment 3

[0065] Example 3 Restriction digestion and homologous recombination of pShuttle-CMV vector

[0066] 1) Digest the pShuttle-CMV vector, and the restriction system is shown in Table 4.

[0067] Table 4 enzyme digestion system

[0068] Reaction solution composition

volume

Plasmid (350μg / μL)

20 μL

10×Buffer

5μL

KpnI

2μL

Hind III

2μL

wxya 2 o

31μL

total

50μL

[0069] After adding the sample and mixing it, place it at 37°C for enzyme digestion for 6 hours. After the reaction, use 1% agarose gel electrophoresis to detect the size of the digested band, and use a gel recovery kit to recover the linearized plasmid.

[0070] 2) Vector and fragment homologous recombination:

[0071] Table 5 Reaction system of vector and fragment homologous recombination

[0072]

[0073]

[0074] Wherein CTLA4-EP153-P54 is the aforementioned PCR product 4.

[0075] React at 37°C for 35 minutes, transform DH5α E...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a method for establishing a recombinant adenovirus vector with Africa swine fever EP153R and P54 gene coexpression and packaging adenovirus and belongs to the technical field ofgene engineering. According to the adenovirus vector of coexpression of the EP153R gene and the P54 gene, with a pShuttle-CMV eukaryotic expression vector as a basis, the CTLA4, EP153R and P54 genesare introduced at multiple cloning sites. The invention further provides recombinant adenovirus with coexpression of the EP153R and P54 genes. The established pAD-Shuttle-CMV-CTLA4-EP153R-P54 vector is used for achieving the adenovirus packaging process, the adenovirus which can directly infect animals or eukaryocyte is obtained, the aim of coexpression of the EP153R and P54 genes in eukaryocyte is achieved, and the basis is laid for research on adenovirus vaccines of coexpression of the EP153R and P54 genes.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant adenovirus vector for co-expression of African swine fever virus CTLA4, EP153R and P54 genes, a construction method and an adenovirus packaging method. Background technique [0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African swine fever virus (ASFV). It is characterized by short course of disease, high fatality rate, clinical symptoms and pathological changes similar to acute swine fever, manifested as high fever, skin congestion, abortion, edema and organ hemorrhage. ASFV is an icosahedral virus with a diameter of 200nm. The virus contains a DNA core with a diameter of 70-100nm, surrounded by an icosahedral capsid with a diameter of 172-191nm and a lipid-containing capsule. The ASFV genome is a single-molecule linear double-stranded DNA whose ends are covalently closed, with a size of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/861C12N15/66C12N7/01A61K39/12A61P31/20
Inventor张泉黄明生谢灵志朱立麒殷俊
OwnerYANGZHOU UNIV