Phloem specific expressing promoter

A promoter and promoter sequence technology, applied to cells modified by introducing foreign genetic material, biochemical equipment and methods, applications, etc., to achieve the effect of eliminating gene silencing, efficient and economical disease resistance

Inactive Publication Date: 2005-05-11
ZHEJIANG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sustained and efficient expression of exogenous genes in recipient plants often negatively affects the growth and development of plants, and sometimes runs counter to the research purpose of specific expression of exogenous genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phloem specific expressing promoter
  • Phloem specific expressing promoter
  • Phloem specific expressing promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Construction of full-length promoter and deletion promoter

[0055] Molecular techniques were performed essentially as described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY, 1989).

[0056] Cloning and Sequencing of βC1 ORF Promoter Fragment of Chinese Tomato Yellow Leaf Curl Virus DNAβ

[0057] Tobacco leaves infected with Chinese tomato yellow leaf curl virus were used as materials, and the total plant DNA was extracted by CTAB method [Murray MG et al., 1987, EMBO J, 6: 3901-3907]. See the pre-amplified promoter fragments figure 1 . Using the total plant DNA as a template, each promoter fragment of the βC1 ORF of Chinese tomato yellow leaf curl virus DNAβ was amplified by specific primers. Primers FL (5'CCGAAGCTTTACATATATACG3', corresponding to positions 1-14 in SEQ ID NO1, introduced a HindIII site) and RL (5'AATGGATCCTGAGTCTGTTCTG3', corresponding to positions 955-94...

Embodiment 2

[0058] Example 2 Construction of GUS fusion expression vector

[0059] The binary expression vector pINT121 (the vector was donated by Fang Rongxiang, academician of the Institute of Microbiology, Chinese Academy of Sciences) was digested with restriction enzymes HindIII and BamHI, and the full-length promoter and various deleted promoter fragments were inserted into this site to construct a promoter Expression vector( figure 2 ): pINT-FL for full length promoter construct, pINTΔ784 for promoter 955Δ784 deletion, pINTΔ557 for promoter 955Δ557 deletion, pINTΔ227 for promoter 955Δ227 deletion construct.

[0060] The expression vector pINT121 was double digested with BamHI and EcoR I, and the digested GUS-NOS fragment was inserted into the BamHI / EcoR I site of the expression vector pBINPLUS. The constructed vector was pBINGUS, which was used as a negative control, and the vector pINT121 was used as a positive control ( image 3 ).

Embodiment 3

[0061] Embodiment 3 Agrobacterium Transformation

[0062]The promoter constructs were introduced into Agrobacterium host cells by three-parent mating method [Wang Guanlin, Principles and Technology of Plant Genetic Engineering. Beijing: Science Education Press, 1998]. The specific method is as follows: the constructed promoter expression vector needs to be mediated by the helper plasmid pROK2013 to enter Agrobacterium EHA105. The constructed promoter expression vector was inoculated with 5 ml of LB liquid medium containing Km (50 μg / ml) and cultured overnight at 200 rpm at 37°C; EHA105 was inoculated with 5 ml of YEP liquid medium containing Sm (50 μg / ml) and cultured at 200 rpm at 28°C for 48 hours; inoculate 5 ml of LB liquid medium containing Km (50 μg / ml) with the helper plasmid pROK2013, and culture overnight at 200 rpm at 37°C. Take 400μl of each of the three bacterial solutions, mix them upside down, collect the bacterial solution at 6000rpm for 30 seconds, and wash th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention was involved in the specific promoter of phloem. This promoter was separated from DNAbeta accompanied by China tomato yellow leaf curl virus (TYLCV-CHI). The separated promoter was the sequence of whole promoter of beta ClORF and part of deletion promoter from DNAbeta. The experiment shown that the promoter of beta ClORF from TYLCV-CHI DNAbeta was the specific promoter of the phloem. The invention introduced whole promoter of beta ClORF from TYLCV-CHI DNAbeta, deletion promoter sequence and expression box containing whole promoter of beta ClORF and deletion promoter sequence.

Description

technical field [0001] The present invention relates to DNA constructs and methods for producing transgenic plants. Specifically, the present invention relates to the isolation of the βC1 ORF full-length promoter sequence of Chinese tomato yellow leaf curl virus DNAβ and its missing promoter sequence. The present invention also relates to the construction of a vector box containing the full-length promoter of βC1 ORF of Chinese tomato yellow leaf curl virus DNAβ connected with heterologous genes and the missing promoter. In addition, the present invention also relates to a method for transient expression and stable expression using expression vectors containing various promoters of βC1 ORF of Chinese tomato yellow leaf curl virus DNAβ. Background technique [0002] The purpose of plant genetic engineering is to introduce foreign genes into recipient plants and make them express correctly and effectively. However, this process is affected and restricted by many factors, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/29C12N15/63C12N15/82
Inventor周雪平关翠萍
OwnerZHEJIANG UNIV