Rice mitogen-activated protein kinase and its coded gene and use

A technology for activating protein kinases and mitogens, applied in the field of mitogen-activated protein kinases and their coding genes and applications, can solve the problems of limiting rice yield potential, unbalanced expression of caryopsis endosperm genes, and low filling

Inactive Publication Date: 2006-08-23
BEIJING NORMAL UNIVERSITY
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The low filling of secondary caryopsis in ultra-high-yield rice restricts the realization of rice yield potential. The root cause may be the imbalance of gene expression related to caryopsis endosperm development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice mitogen-activated protein kinase and its coded gene and use
  • Rice mitogen-activated protein kinase and its coded gene and use
  • Rice mitogen-activated protein kinase and its coded gene and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, the cloning of rice mitogen-activated protein kinase gene OsMAPK6

[0033] According to the known conserved region of the mitogen-activated protein kinase gene, sequence alignment was performed in the "Hua Da Rice Genome Database" (http: / / btn.genomics.org.cn:8080 / rice / ) to obtain the predicted Full gene sequence of rice mitogen-activated protein kinase. According to the predicted whole gene sequence, three pairs of primers were designed to clone the whole gene. The primer sequences are as follows:

[0034] Primer 1: (upstream primer) 5'-TTGTTCTTGGATGCCATTGTG-3'

[0035]Primer 1: (downstream primer) 5'-GTTGATAATTTCCGGAGG-3';

[0036] Primer 2: (upstream primer) 5'-TTTGAGCGAAGAAAGGTTAC-3'

[0037] Primer 2: (downstream primer) 5'-GAATTGGTCGCATCTGGTCA-3';

[0038] Primer 3: (upstream primer) 5'-CCGGACATACGGTCTTCAC-3'

[0039] Primer 3: (downstream primer) 5'-TTTTACCAAATAATCCGCCGTCT-3';

[0040] Extract the total RNA of rice caryopsis 3 days after headin...

Embodiment 2

[0041] Example 2. Induced expression of OsMAPK6 and detection of its kinase activity

[0042] 1. Induced expression of OsMAPK6

[0043] According to the full-length cDNA sequence of OsMAPK6 obtained in Example 1 and the multiple cloning site of prokaryotic expression vector pET30c (Novegen Company), the primers for amplifying the open reading frame sequence of OsMAPK6 gene are designed, and the primer sequences are as follows:

[0044] Primer 4: (upstream primer) 5'-GGT GAATTC ATGGATTTTCTTCAGTGAATATG-3' (underlined base indicates EcoRI recognition site);

[0045] Primer 5: (downstream primer) 5'-ACA AAGCTT CTAGTACATCCTTGAAACACCA-3' (bases underlined represent HindIII recognition sites).

[0046] The total RNA of the rice caryopsis 3 days after heading was extracted, its cDNA was synthesized by reverse transcription, and then using the cDNA as a template, under the guidance of primers 4 and 5, the open reading frame sequence of the OsMAPK6 gene was amplified by PCR, except...

Embodiment 3

[0050] Example 3, the subcellular localization of OsMAPK6

[0051] Primers were designed according to the OsMAPK6 gene, the green fluorescent protein (GFP) gene sequence and the multiple cloning site of the vector pCAMBIA super 1300 (pBIB super promoter of 1.3kb was introduced after digesting pCAMBIA 1300 with EcoRI and HindIII). The primer sequences are as follows:

[0052] Primer 6: (upstream primer) 5'-CG CCCGGG ATTTTCTTCAGTGAATATGG-3' (the underlined base is the Xma I recognition site);

[0053] Primer 6: (downstream primer) 5'- TCCTCGCCCTTGCTCACCAT GTACATCCTTGA AA CACCATAT-3' (underlined base is GFP sequence);

[0054] Primer 7: (upstream primer) 5'- ATATGGTGTTTCAAGGATGTAC ATGGTGAGCAAGGGCGAGGA-3' (the underlined base is the OsMAPK6 sequence)

[0055] Primer 7: (downstream primer) 5'-GGC GGTACC TTACTTGTACAGCTCGTCCA-3' (the underlined base is the KpnI recognition site);

[0056] Primer 8: (upstream primer) 5'-TCA CCCGGG TGAGCAAGGGCGAG-3' (the underlined base is ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a kind of rice mitogen-activated protein kinase and its coding gene and application in breeding very high yield rice variety. The kinase protein with one of the following amino acid residue sequence: 1) SEQ ID No. 1 in the sequence list; and 2. the amino acid residue sequence of SEQ ID No. 1 through substitution, deletion or addition of 1-10 amino acid residues and coding rice grain growth related protein. By means of transgenic technology, the present invention improves the effect of OsMAPK6 on grain shape construction to regulate the activity of grain in accumulating matter and reach the aim of increasing rice yield.

Description

technical field [0001] The invention relates to a mitogen-activated protein kinase and its coding gene and application, in particular to a rice mitogen-activated protein kinase and its coding gene and its application in cultivating super-high-yielding rice varieties. Background technique [0002] Mitogen-activated protein kinase (MAPK) is an important serine / threonine signaling family widely present in plants. Plant MAPK and some other signaling molecules constitute the MAPK cascade pathway (MAPK cascade), which participates in various physiological activities from cytoplasmic movement to plant growth and development and resistance to adversity stress. When plants are subjected to certain stresses, such as ultraviolet radiation, osmotic stress, cold stress, and trauma, or stimulated by cytokines and hormones, plant MAPKs will be activated by different upstream signals that are activated by various internal and external stimuli. Molecular activation, through the phosphorylat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N9/12C12N15/54C12N15/82C12N5/10
Inventor王英典陈星魏茂玲程伟王欣生
OwnerBEIJING NORMAL UNIVERSITY