Rice mitogen-activated protein kinase and its coded gene and use
A technology for activating protein kinases and mitogens, applied in the field of mitogen-activated protein kinases and their coding genes and applications, can solve the problems of limiting rice yield potential, unbalanced expression of caryopsis endosperm genes, and low filling
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1, the cloning of rice mitogen-activated protein kinase gene OsMAPK6
[0033] According to the known conserved region of the mitogen-activated protein kinase gene, sequence alignment was performed in the "Hua Da Rice Genome Database" (http: / / btn.genomics.org.cn:8080 / rice / ) to obtain the predicted Full gene sequence of rice mitogen-activated protein kinase. According to the predicted whole gene sequence, three pairs of primers were designed to clone the whole gene. The primer sequences are as follows:
[0034] Primer 1: (upstream primer) 5'-TTGTTCTTGGATGCCATTGTG-3'
[0035]Primer 1: (downstream primer) 5'-GTTGATAATTTCCGGAGG-3';
[0036] Primer 2: (upstream primer) 5'-TTTGAGCGAAGAAAGGTTAC-3'
[0037] Primer 2: (downstream primer) 5'-GAATTGGTCGCATCTGGTCA-3';
[0038] Primer 3: (upstream primer) 5'-CCGGACATACGGTCTTCAC-3'
[0039] Primer 3: (downstream primer) 5'-TTTTACCAAATAATCCGCCGTCT-3';
[0040] Extract the total RNA of rice caryopsis 3 days after headin...
Embodiment 2
[0041] Example 2. Induced expression of OsMAPK6 and detection of its kinase activity
[0042] 1. Induced expression of OsMAPK6
[0043] According to the full-length cDNA sequence of OsMAPK6 obtained in Example 1 and the multiple cloning site of prokaryotic expression vector pET30c (Novegen Company), the primers for amplifying the open reading frame sequence of OsMAPK6 gene are designed, and the primer sequences are as follows:
[0044] Primer 4: (upstream primer) 5'-GGT GAATTC ATGGATTTTCTTCAGTGAATATG-3' (underlined base indicates EcoRI recognition site);
[0045] Primer 5: (downstream primer) 5'-ACA AAGCTT CTAGTACATCCTTGAAACACCA-3' (bases underlined represent HindIII recognition sites).
[0046] The total RNA of the rice caryopsis 3 days after heading was extracted, its cDNA was synthesized by reverse transcription, and then using the cDNA as a template, under the guidance of primers 4 and 5, the open reading frame sequence of the OsMAPK6 gene was amplified by PCR, except...
Embodiment 3
[0050] Example 3, the subcellular localization of OsMAPK6
[0051] Primers were designed according to the OsMAPK6 gene, the green fluorescent protein (GFP) gene sequence and the multiple cloning site of the vector pCAMBIA super 1300 (pBIB super promoter of 1.3kb was introduced after digesting pCAMBIA 1300 with EcoRI and HindIII). The primer sequences are as follows:
[0052] Primer 6: (upstream primer) 5'-CG CCCGGG ATTTTCTTCAGTGAATATGG-3' (the underlined base is the Xma I recognition site);
[0053] Primer 6: (downstream primer) 5'- TCCTCGCCCTTGCTCACCAT GTACATCCTTGA AA CACCATAT-3' (underlined base is GFP sequence);
[0054] Primer 7: (upstream primer) 5'- ATATGGTGTTTCAAGGATGTAC ATGGTGAGCAAGGGCGAGGA-3' (the underlined base is the OsMAPK6 sequence)
[0055] Primer 7: (downstream primer) 5'-GGC GGTACC TTACTTGTACAGCTCGTCCA-3' (the underlined base is the KpnI recognition site);
[0056] Primer 8: (upstream primer) 5'-TCA CCCGGG TGAGCAAGGGCGAG-3' (the underlined base is ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 