Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine
A technology of rv3425 and BCG, which is applied in the field of genetic engineering, can solve the problems of great differences in protective effect and no protective effect of adult tuberculosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Construction of recombinant BCG rBCG::Ag85B-Rv3425
[0033] Primer Ag85B(P 上 : 5'GCGAATTCATGACAGACGTGAGCCGAAAGATTC;P 下 : 5'TGTCGACCTAGCCGGCGCCTAACGAACTCTGG); Rv3425(P 上 : 5'CGAATTCATGCATCCAATGATACCAGC;P 下 : 5'ATTAAGCTTCTACCCGCCCCTGTAGATCT). The Ag85B gene was amplified by PCR using the genomic DNA of the H37Rv strain as a template. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 45 seconds, renaturation at 62°C for 45 seconds, extension at 72°C for 2 minutes and 30 seconds, 30 cycles; extension at 72°C for 12 minutes. The Rv3425 gene was amplified by PCR using the genomic DNA of the H37Rv strain as a template. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 45 seconds, renaturation at 60°C for 60 seconds, extension at 72°C for 1 minute, 30 cycles; extension at 72°C for 10 minutes. The PCR reaction product of the Ag85B gene was purif...
Embodiment 2
[0035] Example 2 Observation of immune characteristics of rBCG::Ag85B-Rv3425 cells
[0036] C57BL / c mice were immunized with rBCG::Ag85B-Rv3425 bacterin, and Bacillus Calmette-Guerin (BCG) was used as a control. 4 weeks after immunization, ELISpot technology was used to detect the expression of IFN-γ after splenocytes were stimulated by PPD, Ag85B protein and Rv3425 protein. The specific steps are: the PVDF plate is pre-coated with IFN-γ antibody overnight, and the blocking reagent in the kit is blocked at 37°C for 1 hour. The mouse spleen was aseptically removed, ground and filtered through a 200-mesh sieve, and lymphocytes were separated by lymphocyte separation medium. Add an appropriate number of lymphocytes into a 96-well PVDF plate, and give PPD, Ag85B and Rv3425 protein stimulation. After co-incubating for 48 hours, add detection antibodies and other reagents in sequence according to the ELISpot operation instructions, wash the plate, develop color, and read the numbe...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap