Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine

A technology of rv3425 and BCG, which is applied in the field of genetic engineering, can solve the problems of great differences in protective effect and no protective effect of adult tuberculosis

Inactive Publication Date: 2006-12-27
FUDAN UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the protective effect of BCG varies widely (0-80%) in different regions
Although effective in preventing severe TB in children, it offers little protection against TB in adults

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine
  • Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine
  • Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Construction of recombinant BCG rBCG::Ag85B-Rv3425

[0033] Primer Ag85B(P 上 : 5'GCGAATTCATGACAGACGTGAGCCGAAAGATTC;P 下 : 5'TGTCGACCTAGCCGGCGCCTAACGAACTCTGG); Rv3425(P 上 : 5'CGAATTCATGCATCCAATGATACCAGC;P 下 : 5'ATTAAGCTTCTACCCGCCCCTGTAGATCT). The Ag85B gene was amplified by PCR using the genomic DNA of the H37Rv strain as a template. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 45 seconds, renaturation at 62°C for 45 seconds, extension at 72°C for 2 minutes and 30 seconds, 30 cycles; extension at 72°C for 12 minutes. The Rv3425 gene was amplified by PCR using the genomic DNA of the H37Rv strain as a template. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 45 seconds, renaturation at 60°C for 60 seconds, extension at 72°C for 1 minute, 30 cycles; extension at 72°C for 10 minutes. The PCR reaction product of the Ag85B gene was purif...

Embodiment 2

[0035] Example 2 Observation of immune characteristics of rBCG::Ag85B-Rv3425 cells

[0036] C57BL / c mice were immunized with rBCG::Ag85B-Rv3425 bacterin, and Bacillus Calmette-Guerin (BCG) was used as a control. 4 weeks after immunization, ELISpot technology was used to detect the expression of IFN-γ after splenocytes were stimulated by PPD, Ag85B protein and Rv3425 protein. The specific steps are: the PVDF plate is pre-coated with IFN-γ antibody overnight, and the blocking reagent in the kit is blocked at 37°C for 1 hour. The mouse spleen was aseptically removed, ground and filtered through a 200-mesh sieve, and lymphocytes were separated by lymphocyte separation medium. Add an appropriate number of lymphocytes into a 96-well PVDF plate, and give PPD, Ag85B and Rv3425 protein stimulation. After co-incubating for 48 hours, add detection antibodies and other reagents in sequence according to the ELISpot operation instructions, wash the plate, develop color, and read the numbe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention is associated with the gene engineering field and tuberculosis vaccines field. In recent decades, the increase of tuberculosis drug resistant strain and the coinfection of mycobacterium tuberculosis and HIV lead the increase of incidence of tuberculosis, and made it the second killer of human after HIV. Recently, the only tuberculosis vaccines used globally is BCG. This invention inserts the most important protective antigen gene of mycobacterium tuberculosis and missed mycobacterium tuberculosis gene in BCG to the multi-cloning coliform - mycobacterium tuberculosis shuttle-plasmid multiple cloning sites to form recombined plasmid and transforms it to the BCG to form recombined tuberculosis vaccines. The result of experiment shows that, compared with BCG vaccine, the protective antigen can express more efficient, the original missing Rv3425 antigen also get expressed, and the induced IFN- gamma expression also increased significently. This indicates that the recombined tuberculosis vaccines can induce higher cell immunity level than BCG.

Description

technical field [0001] The invention relates to the field of genetic engineering and the field of novel vaccine development, in particular, the invention provides a novel and improved recombinant Ag85B-Rv3425 BCG. Background technique [0002] In the past ten years, due to the increase of tuberculosis drug-resistant strains and the co-infection of Mycobacterium tuberculosis and HIV, the incidence of tuberculosis has increased, and it has become the second largest killer of human beings after HIV. The only TB vaccine currently in widespread use worldwide is BCG. However, the protective effect of BCG varies widely (0-80%) in different regions. Although it is effective in preventing severe TB in children, it offers little protection against TB in adults. Therefore, it is urgent to develop new and effective tuberculosis vaccines, which is of great significance for controlling tuberculosis infection. Studies of TB subunit vaccines have shown that they do not provide protection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/33C12N15/62A61K39/04A61P31/06
Inventor 王洪海王九玲张红梅郄亚卿祝秉东徐颖王庆忠
Owner FUDAN UNIV