Method for treating synovial sarcoma using sirna for fzd10
A molecular and expression vector technology, applied in the field of treatment and/or prevention of FZD10-related diseases in subjects, can solve the problems of unclear FZD10 cell function and implication, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Construction of siRNA expression vector
[0067] To study the cellular function of FZD10, we constructed a plasmid (psiU6BX-FZD10) expressing siRNA specific to FZD10 under the control of U6 promoter. Two siRNAs (psiU6BX-FZD10B and C) were constructed based on the FZD10ORF sequence.
[0068] (1) Construction of siRNA expression vector psiU6X3.0
[0069] Because the snRNA U6 gene is reported to be transcribed by RNA polymerase III, which produces short transcripts with uridine at the 3' end, we amplified the genome of the snRNA U6 gene containing its promoter region by PCR Fragment, the PCR utilized a set of primers 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No. 11) and 5'-TAGGCCC CACCTCCTTCTAT-3' (SEQ ID No. 12) and human placental DNA as templates. The product was purified and cloned into the pCR plasmid vector using the TA cloning kit according to the manufacturer's protocol (Invitrogen). The BamHI, XhoI digested fragment containing the snRNA U6 gene was purified and cloned...
Embodiment 2
[0101] Effect of FZD10-siRNA on the growth of synovial sarcoma cell line
[0102] We transfected the plasmid prepared in Example 1 into the synovial sarcoma cell line SYO-1 and checked the expression level of FZD10 by semi-quantitative RT-PCR. Likewise, we performed cell growth assays to confirm cell growth inhibition.
[0103] (1) Semi-quantitative RT-PCR
[0104] SYO-1 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. Using the cell line Nucleofector TM Kit V (Amaxa Biosystems, Cologne, Germany) was used to transfect SYO-1 cells. Transfected cells were assayed 48-72 hours after transfection.
[0105] Total RNA was extracted from transfected cells using TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. The extracted RNA was treated with DNase I (Roche Diagnostics, Mannheim, Germany) and oligo(dT) 12-18Primers were reverse transcribed into single-stranded cDNA using Superscript II rev...
Embodiment 3
[0115] Formation of FZD10 homodimers
[0116] Since FZD1, a member of the Frizzled family, has been reported to form oligomers (Kaykas A, et al. (2004). Nat. Cell Biol. 6:52-8), we investigated whether FZD10 is also capable of oligomerization by immunoprecipitation. Two FZD10 constructs, HA-FLAG-FZD10 (described below) and FZD10-myc-His (prepared in Example 1; Figure 2A), were co-transfected into COS-7 cells and co-transfected using α-HA antibody. Immunoprecipitation.
[0117] For the construction of HA-FLAG-FZD10, the following set of oligonucleotides, 5'-ACGT GTC GAC TACCCATACGACGTCCCAGACTACGCTATGGACTACAAGGACGACGATGACAAGCTCGAGATGC-3' (SEQ ID No.37) (the underline indicates the SalI site) and 5'-GCAT CTCGAG CTTGTCATCGTCGTCCTTGTAGTCCATAGCGTAGTCTGGGACGTCGTATGGGTAGTCGACACGT-3' (SEQ ID NO. 38) (XhoI site underlined) was annealed and digested with SalI and XhoI to generate the HA-FLAG tag. First, residues 1-217 and 218-stop codon (or C-terminal deletion) fragments were PCR am...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com