Polymorphisms in the Epidermal Growth Factor Receptor Gene Promoter

a technology of epidermal growth factor and gene promoter, which is applied in the field of molecular biology and oncology, can solve the problems that the variable expression of egfr may directly affect drug response and toxicity, and achieve the effect of reducing the toxicity of egfr-targeting therapeutic agents

Inactive Publication Date: 2007-11-29
UNIVERSITY OF CHICAGO
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011] The present invention discloses twelve polymorphisms in the EGFR 5′ regulatory region. More particularly, the inventors demonstrated that the −216G>T polymorphism is associated with increased expression from the EGFR promoter region. The identification of polymorphisms associated with EGFR expression enables novel methods and compositions for evaluating the potential efficacy and / or toxicity of an EGFR-targeting therapeutic agent, predicting a patient's clinical prognosis, and evaluating a patient's risk of developing a disease that is associated with EGFR dysregulation.

Problems solved by technology

Because EGFR is the direct target of a number of anticancer drugs, variable expression of EGFR may directly affect drug response and toxicity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polymorphisms in the Epidermal Growth Factor Receptor Gene Promoter
  • Polymorphisms in the Epidermal Growth Factor Receptor Gene Promoter
  • Polymorphisms in the Epidermal Growth Factor Receptor Gene Promoter

Examples

Experimental program
Comparison scheme
Effect test

example 1

Discovery of Single Nucleotide Polymorphisms (SNPs) in EGFR Regulatory Region

[0158] DNA samples from Coriell Cell Repository were used for resequencing. The samples include 22 Caucasians, 23 African-Americans and 23 Asians. For SNP discovery, PCR was used to amplify the approximately 4.5 kb fragment containing the upstream and downstream enhancer, promoter, exon 1 and part of intron 1 using the primers in Table 1. Purified PCR products were directly sequenced from both ends. ABI-3700 capillary sequencer and a phred / phrap / polyphred / consed pipeline (World Wide Web at phrap.org / ) were used to identify the polymorphisms.

TABLE 1SEQ ID NO: 3EGFR1L-FGTTCCACTGTTGTGCTTCCC 4EGFR1L-RAAGAAAGTTGGGAGCGGTTC 5EGFR1L-AFGGGTGGACTTGCCAAAGGA 6EGFR1L-ARCTTAGAGCCAGCGTCGGATA 7EGFR1L-1FGCATGACTTCAACGCACAGT 8EGFR1L-1RGAGGCTAAGTGTCCCACTGC 9EGFR1L-2FTCGGACTTTAGAGCACCACC10EGFR1L-2RGAGGAGGAGAATGCGAGGAG11EGFR1L-3FAAATTAACTCCTCAGGGCACC12EGE11L-3RCGCCCTTACCTTTCTTTTCC13EGFR1L-4FCCCTGACTCCGTCCAGTATT14EGFR2L-FCGTC...

example 2

Functional Characterization of Two Promoter SNPs (−216G>T and −191 C>A).

[0160] Potential function of two SNPs (−216 G>T and −191 C>A) in the EGFR promoter region were characterized by in vitro transient transfection assay and electrophoretic mobility shift assay (EMSA).

[0161] Haplotypes.

[0162] The SNP −216 G>T was found to be frequent in African-Americans (29%) and Caucasians (34%) but relatively rare in Asians (9%), while −191 C>A was only found in Caucasians (18%) when the inventors sequenced the 68 samples from different ethnic groups (Table 3). Linkage disequilibrium and haplotype analysis showed that −216 G>T and −191 C>A are not in strong LD (D′=0.5562, p>0.05,) and three haplotypes were observed in the samples: G-C, G-A and T-C, see Table 3 below. DNA fragments containing these three haplotypes were amplified and cloned while the T-A haplotype was constructed by ligating the T fragment and A fragment from the Dra III digested G-A and T-C haplotypes (FIG. 3).

TABLE 3The ha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Magnetic fieldaaaaaaaaaa
Magnetic fieldaaaaaaaaaa
Magnetic fieldaaaaaaaaaa
Login to View More

Abstract

The present invention concerns polymorphisms in the epidermal growth factor receptor (EGFR), gene. In some embodiments, the present invention is directed at compositions and methods involving single nucleotide polymorphisms (SNPs) in the promoter of the EGFR gene that affect EGFR expression. The identification of polymorphisms associated with EGFR expression or activity enables novel methods and compositions for evaluating the potential efficacy and toxicity of an EGFR-targeting therapeutic agent, predicting a patient's clinical prognosis, and evaluating a patient's risk of developing a disease that is associated with EGFR dysregulation.

Description

[0001] The present invention claims priority to U.S. Provisional Patent Application Ser. No. 60 / 549,069, filed on Mar. 1, 2004, which is hereby incorporated by reference. The government owns rights in the present invention pursuant to grant number U01GM61393 from the National Institutes of Health.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention relates generally to the field of molecular biology and oncology. More particularly, it concerns polymorphisms in the epidermal growth factor receptor (EGFR) gene associated with EGFR expression and activity. In some embodiments, the present invention is directed at compositions and methods involving single nucleotide polymorphisms (SNPs) in the promoter of the EGFR gene that affect EGFR expression. [0004] 2. Description of Related Art [0005] Human epidermal growth factor receptor (EGFR) plays a critical role in the signal transduction pathway of cell proliferation, differentiation and survival. Overex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N33/53
CPCC12Q1/6886C12Q2600/106C12Q2600/172C12Q2600/156C12Q2600/142C12Q1/6858C12Q2600/136
InventorRATAIN, MARK J.LIU, WANQINGINNOCENTI, FEDERICO
OwnerUNIVERSITY OF CHICAGO