Methods for control of flux in metabolic pathways through enzyme relocation
a metabolic pathway and enzyme technology, applied in the field of metabolic pathway flux control through enzyme relocation, can solve the problems of limiting overall yield, affecting the production of compound, etc., and achieves the effect of high level production
Image
Examples
example 1
Production of Shikimic Acid
Shikimic acid is an intermediate in the chorismate biosynthetic pathway, where the key entry enzyme is 2-dehydro-3-deoxyphosphoheptonate aldolase (3-deoxy-D-arabino-heptulosonate-7-phosphate, DAHP, synthase). DAHP synthase catalyzes the first committed step in shikimate production by converting the central metabolites phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) to DAHP. In E. coli, there are three DAHP synthase enzymesâAroG, AroE, and AroFâencoded by genes aroG, aroE, and aroF, respectively. It is common that feedback resistant versions of these enzymes (Kikuchi et al., Appl. Environ. Microbiol. (1997) 63:761; Ray et al., J. Bacteriol. (1988) 170:5500; Weaver and Herrmann, J. Bacteriol. (1990) 172:6581) are used to ensure maximal activity.
In this example, a DAHP synthase gene is modified to contain various periplasmic signal sequences (periplasmic leader peptides) targeting the enzyme to the periplasm. Expression optimization, evaluation of v...
example 2
Growth Effects and Activity of Periplasmically-Expressed AroG
Periplasmic expression of DAHP synthase. A library of plasmids is constructed containing the gene coding for AroG (Genbank Acc. no. AAC73841.1) modified with various periplasmic signal sequences targeting the enzyme to the periplasm. The DNA sequences of primers used to construct the coding sequences for the periplasmic leaders tested are set forth in Tables 4 and 5. DNA sequences coding for a set of periplasmic signal sequences are added to the aroG gene through PCR amplification using the following primers:
TABLEâ4PrimersâUsedâtoâAddâPeriplasmicâTargetingâSignalsâtoâaroGLeaderPrimerSequencenoneFâ5â˛gcaattcggtctcccatgaattatcagaacgacgatttacgcatc(SEQâIDâNO:â11)Râ3â˛gaattcgcggccgcttacccgcgacgcgcttttac(SEQâIDâNO:â12)OmpAFâ5â˛gcaattcggtctcccatgaaaaaaacggcaattgcgatagcg(SEQâIDâNO:â13)Râ3â˛gaattcgcggccgcttacccgcgacgcgcttttac(SEQâIDâNO:â14)StIIFâ5â˛gcaattcggtctcccatgaaaaaaaatattgctttcctgctcg(SEQâIDâNO:â15)Râ3â˛gaattcgcggccgcttacccgcgacgc...
example 3
Cell Free Production of Isobutanol and / or 1-butanol
Current methods for production of isobutanol in E. coli rely on over-expression of the E. coli enzymes of valine biosynthesis IlvI,H,C,D in concert with overexpression of two heterologous enzymes: the alcohol dehydrogenase 2 enzyme of S. cerevisiae (ADH2, GenBank AAA34411.1) and the 2-keto-acid decarboxylase enzyme of L. lactis (KivD, GenBank CAG34226.1) (see, e.g., Atsumi et al., Nature (2008) 451:86). Similarly, production of 1-butanol requires the overexpression of the same two heterologous enzymes (ADH, KivD) combined with overexpression of IlvA and LeuABCD enzymes of isoleucine and leucine biosynthesis in E. coli (Atsumi ibid). Accumulation of higher alcohols (e.g., isobutanol, 1-butanol, n-butanol) is toxic at very low levels, 2% (w / v) (Atsumi ibid; Reyes et al., Plos One (2011) 6:e17678) resulting in poor cell growth and poor product titers when these pathways are active in growing E. coli.
Periplasmic relocation of the key e...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Angle | aaaaa | aaaaa |
| Density | aaaaa | aaaaa |
| Level | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- IPC
- C12P1/00; C12N9/00; C12N1/21; C12N1/19; C12N5/10; C12N1/15; C12N1/11; C12N15/63; C12N1/13
- CPC
- C07K2319/034; C12N9/1029; C12N9/88; C12N15/625; Y02E50/10; C12P7/42; C12P7/625; C12P23/00
- Inventors
- SWARTZ, JAMES R.



