Supercharge Your Innovation With Domain-Expert AI Agents!

Compositions and Methods For High Fidelity Assembly of Nucleic Acids

a nucleic acid and high-fidelity technology, applied in the field of nucleic acid assembly, can solve the problem of relatively high error rate of assembly techniques

Inactive Publication Date: 2013-03-07
GEN9
View PDF7 Cites 96 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention provides methods and systems for producing target nucleic acids by assembling blunt-end double-stranded nucleic acid fragments and cohesive-end double-stranded nucleic acid fragments. The methods involve synthesizing the starting nucleic acids on a solid support, digesting them with a restriction enzyme, and ligating them to form the target nucleic acid. The invention also includes computer software for designing the starting nucleic acids based on the target sequence. The technical effects of the invention include improved accuracy and efficiency in producing target nucleic acids.

Problems solved by technology

However, one limitation of currently available assembly techniques is the relatively high error rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and Methods For High Fidelity Assembly of Nucleic Acids
  • Compositions and Methods For High Fidelity Assembly of Nucleic Acids
  • Compositions and Methods For High Fidelity Assembly of Nucleic Acids

Examples

Experimental program
Comparison scheme
Effect test

examples

[0139]FIG. 1 shows the sequence of an arbitrarily chosen, double-stranded sequence of about 836 bp long. 60-bp fragments were selected and labeled 1 to 28 (fragments 1-14 are on the positive strand; fragments 15-28 on the negative strand). These 60-bp fragments were ordered from IDT (Integrated DNA Technologies, Coralville, Iowa) (“IDT oligos”), with the following flanking sequences:

GTCACTACCGCTATCATGGCGGTCTC . . . GAGACCAGGAGACAGGACCGACCAAACAGTGATGGCGATAGTACCGCCAGAG . . . CTCTGGTCCTCTGTCCTGGCTGGTTT

Underlined is the recognition site of BsaI-HF, which produces a 4-base overhang:

5′ . . . GGTCTC(N)1▾ . . . 3′3′ . . . CCAGAG(N)5▴ . . . 5′

The BsaI-HF recognition sites are flanked by universal primers which are useful for amplification of these fragments.

[0140]PCR primers A-E were also designed (dashed arrows in FIG. 1) for amplifying the correct ligation product. FIG. 2 shows the relative position of the primers (“oligoA” to “oligoE”) as arrowheads, as well as the predicted size of corre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting temperaturesaaaaaaaaaa
affinityaaaaaaaaaa
sizeaaaaaaaaaa
Login to View More

Abstract

Aspects of the invention relate to methods, compositions and algorithms for designing and producing a target nucleic acid. The method can include: (1) providing a plurality of blunt-end double-stranded nucleic acid fragments having a restriction enzyme recognition sequence at both ends thereof; (2) producing via enzymatic digestion a plurality of cohesive-end double-stranded nucleic acid fragments each having two different and non-complementary overhangs; (3) ligating the plurality of cohesive-end double-stranded nucleic acid fragments with a ligase; and (4) forming a linear arrangement of the plurality of cohesive-end double-stranded nucleic acid fragments, wherein the unique arrangement comprises the target nucleic acid. In certain embodiments, the plurality of blunt-end double-stranded nucleic acid fragments can be provided by: releasing a plurality of oligonucleotides synthesized on a solid support; and synthesizing complementary strands of the plurality of oligonucleotides using a polymerase based reaction.

Description

RELATED APPLICATIONS[0001]This application claims the benefit of and priority to U.S. Provisional Application Ser. No. 61 / 527,922, filed Aug. 26, 2011, and U.S. Provisional Application Ser. No. 61 / 532,825, filed Sep. 9, 2011, each of which is incorporated herein by reference in its entirety.FIELD OF THE INVENTION[0002]Methods and compositions of the invention relate to nucleic acid assembly, and particularly to high fidelity, multiplex nucleic acid assembly reactions.BACKGROUND[0003]Recombinant and synthetic nucleic acids have many applications in research, industry, agriculture, and medicine. Recombinant and synthetic nucleic acids can be used to express and obtain large amounts of polypeptides, including enzymes, antibodies, growth factors, receptors, and other polypeptides that may be used for a variety of medical, industrial, or agricultural purposes. Recombinant and synthetic nucleic acids also can be used to produce genetically modified organisms including modified bacteria, y...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12P19/34C40B60/14C40B40/06C12Q1/68C40B50/02G16B30/20
CPCC12P19/34C12N15/10C12N15/1027C12N15/1031C12N15/1089C12N15/66G06F19/22C12Q2521/301C12Q2521/501G16B30/00G16B30/20
Inventor JACOBSON, JOSEPHSCHINDLER, DANIELLAWTON, SCOTT S.
Owner GEN9
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More