Antisense oligonucleotide directed removal of proteolytic cleavage sites, the hchwa-d mutation, and trinucleotide repeat expansions

a technology of proteolytic cleavage and antisense oligonucleotide, which is applied in the field of biotechnology and genetic and acquired diseases, can solve the problems of difficult implementation of such strategies in the clini

Inactive Publication Date: 2014-02-06
ACADEMISCH ZIEKENHUIS BIJ DE UNIV VAN AMSTERDAM ACADEMISCH MEDISCH CENT
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent is about a new way to reduce the harmful effects of a mutant protein called ataxin-3, which is associated with a neurodegenerative disorder called spinocerebellar ataxia (SCA). The method involves using special RNA molecules called AONs to stop the production of ataxin-3 by specifically targeting a part of the gene that codes for the protein. This approach does not require modifying the gene itself, but rather prevents the production of harmful parts of the protein. By doing this, it is possible to reduce the toxic properties of ataxin-3 while maintaining its normal functions. This patent is useful for treating individuals with SCA and other neurodegenerative disorders caused by the buildup of harmful proteins.

Problems solved by technology

Although this can be done in the laboratory, it is difficult to implement such strategies in the clinic, if only because gene therapy applications that rely on the introduction of a complete gene are, at present, not very efficient, and the original gene associated with the problem is not removed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antisense oligonucleotide directed removal of proteolytic cleavage sites, the hchwa-d mutation, and trinucleotide repeat expansions
  • Antisense oligonucleotide directed removal of proteolytic cleavage sites, the hchwa-d mutation, and trinucleotide repeat expansions
  • Antisense oligonucleotide directed removal of proteolytic cleavage sites, the hchwa-d mutation, and trinucleotide repeat expansions

Examples

Experimental program
Comparison scheme
Effect test

example 1

AON-Mediated Exon Skipping in Neurodegenerative Diseases to Remove Proteolytic Cleavage Sites

[0110]AON-mediated exon skipping in Huntington's disease to remove proteolytic cleavage sites from the huntingtin protein.

Methods

AONs and Primers

[0111]All AONs consisted of 2′-O-methyl RNA and full length phosphorothioate backbones.

Cell Cultures and AON Transfection

[0112]Patient fibroblast cells and human neuroblastoma cells were transfected with AONs at concentrations ranging between 1 and 1000 nM using Polyethylenemine (PEI) ExGen500 according to the manufacturer's instructions, with 3.3 μl PEI per μg of transfected AON. A second transfection was performed 24 hours after the first transfection. RNA was isolated 24 hours after the second transfection and cDNA was synthesized using random hexamer primers.

Cell Lines Used:

[0113]FLB73 Human Fibroblast Control

[0114]GM04022 Human Fibroblast HD

[0115]GMO2173 Human Fibroblast HD

[0116]SH-SY5Y Neuroblastoma Control

[0117]Quantitative Real-Time PCR (qRT...

example 2

AON Mediated Skipping of htt Exon 12 or 13 in Human Fibroblasts

[0127]The caspase-6 site at amino acid position 586 previously shown to be important in disease pathology is encoded partly in exon 12 and partly in exon 13. Exon 12 also encodes two active caspase-3 sites at amino acids 513 and 552 (10, 33). Skipping of both exon 12 and 13 would maintain the open reading frame and therefore is anticipated to generate a shorter htt protein lacking these 3 caspase sites (see FIG. 6). The AONs used in this study are shown below.

AON Name Sequence (5′-3′):(SEQ ID NO: 182)hHTTEx12_7GUCCCAUCAUUCAGGUCCAU(SEQ ID NO: 178)hHTTEx12_5CUCAAGAUAUCCUCCUCAUC(SEQ ID NO: 190)hHTTEx13_1GGCUGUCCAAUCUGCAGG(SEQ ID NO: 238)Control AONUCCUUUCAUCUCUGGGCUC(SEQ ID NO: 239)mAON12.1GGCUCAAGAUGUCCUCCUCAUCC(SEQ ID NO: 240)mAON12.2UUUCAGAACUGUCCGAAGGAGUC(SEQ ID NO: 241)mAON13GGCUGUCCUAUCUGCAUG(SEQ ID NO: 242)Scrambled AONCUGAACUGGUCUACAGCUC(SEQ ID NO: 243)Alexa488 AONGGUACACCUAGCGGAACAAU

[0128]AONs were transfected in h...

example 3

Removal of the 586 Caspase-6 Cleavage Site from Mouse htt Protein In Vitro and in Vivo

[0132]To investigate the potential of htt exon skipping in vivo and to test if removal of the amino acid sequence surrounding the 586 caspase-6 cleavage site could be harmful in vivo, AONs homologues to the mouse sequence was designed. Since mice do not exhibit the cryptic splice site that is responsible for the partial skip in human cells, the full skip of exon 12 and 13 as was described for the human cells was investigated. Transfection of 200 nM of each mouse specific htt AON targeting exon 12 and 13 in mouse C2C12 cells showed a skip of both exons with an efficiency of 86.8% (±5.6) (FIGS. 10A and 10B).

[0133]To investigate distribution of the AON in the mouse brain, 10 μg of Alexa Fluor 488 labeled control AON was injected bilaterally into the striatum of a control mouse. The mouse was sacrificed after one week, the brain was perfused, and sections were immunolabeled using the neuronal marker Ne...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Described are methods for removing a proteolytic cleavage site, the HCHWA-D mutation or the amino acids encoded by a trinucleotide repeat expansion from a protein comprising providing a cell that expresses pre-mRNA encoding the protein with an anti-sense oligonucleotide that induces skipping of the exonic sequence that comprises the proteolytic cleavage site, HCHWA-D mutation or trinucleotide repeat expansion, respectively, the method further comprising allowing translation of mRNA produced from the pre-mRNA.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is a continuation-in-part of U.S. patent application Ser. No. 13 / 814,203, filed Apr. 12, 2013, pending, which application is a national phase entry under 35 U.S.C. §371 of International Patent Application PCT / NL2011 / 050549, filed Aug. 4, 2011, designating the United States of America and published in English as International Patent Publication WO 2012 / 018257 A1 on Feb. 9, 2012, which claims the benefit under Article 8 of the Patent Cooperation Treaty and under 35 U.S.C. §119(e) to U.S. Provisional Patent Application Ser. No. 61 / 370,855, filed Aug. 5, 2010, and to European Patent Application Serial No. 10172076.1, filed Aug. 5, 2010, the entire disclosure of each of which is hereby incorporated herein by this reference.STATEMENT ACCORDING TO 37 C.F.R. §1.821(c) or (e)—SEQUENCE LISTING SUBMITTED AS A TXT AND PDF FILES[0002]Pursuant to 37 C.F.R. §1.821(c) or (e), files containing a TXT version and a PDF version of the Sequen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/113
CPCC12N15/113C12N15/111C12N2310/11C12N2320/33C12N2310/315C12N2310/346C12Y304/19012A61P21/00A61P25/00C12N2310/321C12N2310/3521C12N15/1137
InventorVAN ROON-MOM, WIHELMINA M. C.EVERS, MELVIN MAURICEPEPERS, BARRY ANTONIUSAARTSMA-RUS, ANNEMIEKEVAN OMMEN, GARRIT-JAN BOUDEWIJN
OwnerACADEMISCH ZIEKENHUIS BIJ DE UNIV VAN AMSTERDAM ACADEMISCH MEDISCH CENT