Unlock instant, AI-driven research and patent intelligence for your innovation.

High Affinity TCR Proteins and Methods

a tcr protein and high affinity technology, applied in the field of molecular biology, can solve the problems of complex sequence diversity in antibody and tcr variable (v) regions, complicating efforts to discern what features of the v regions, etc., to achieve block autoimmune destruction, prevent or inhibit replication, and high affinity

Inactive Publication Date: 2015-08-20
THE BOARD OF TRUSTEES OF THE UNIV OF ILLINOIS
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This method allows for the isolation of TCR proteins with significantly higher affinity (up to 100-fold) for peptide / MHC complexes, retaining peptide specificity, and can be used in diagnostic and therapeutic applications, such as detecting tumor cells or blocking autoimmune destruction, by leveraging yeast display technology and directed evolution.

Problems solved by technology

One of the difficulties in exploring the basis of differences between Fab and TCR has been that the extensive sequence diversity in antibody and TCR variable (V) regions complicates efforts to discern what features of the V regions are important for functions other than antigen binding (e.g., V region pairing and association kinetics, stability, and folding).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High Affinity TCR Proteins and Methods
  • High Affinity TCR Proteins and Methods
  • High Affinity TCR Proteins and Methods

Examples

Experimental program
Comparison scheme
Effect test

example 1

Library Construction

[0088]The 2C scTCR used as the scaffold for directed evolution (T7) contained six mutations (βG17E, βG42E βL81S, αL43P, αW82R, and αI118N) that have been shown to increase the stability of the TCR but still allow pMHC binding [see, e.g., Shusta, E. V. et al. (1999) J. Mol. Biol. 292, 949-956].

[0089]Mutagenic PCR of the T7 scTCR VccCDR3 was performed using an AGA2-specific upstream primer (GGCAGCCCCATAAACACACAGTAT (SEQ ID NO:3)) and a degenerate downstream primer CTTTTGTGCCGGATCCAAATGTCAG(SNN)5GCTCACAGCACAGAAGTACACGGCCGAG TCGCTC (SEQ ID NO:4). Underlined bases indicate the positions of silent mutations introducing unique BamHI and EagI restriction sites. The purified PCR product was digested with NdeI and BamHI and ligated to NdeI-BamHI digested T7 / pCT302 [Boder and Wittrup (1997) supra; Kieke et al. (1999) supra; Shusta et al. (1999) supra]. The ligation mixture was transformed into DH10B electro-competent E. coli (Gibco BRI, Gaithersburg, Md.), and transformants...

example 2

Cell Sorting

[0090]The yeast library [Shusta et al. (1999) Curr. Opin. Biotechnol. 10:117-122] was grown in SD-CAA (2% dextrose, 0.67% yeast nitrogen base, 1% casamino acids (Difco, Livonia, Mich.)) at 30EC to an OD600=4.0. To induce surface scTCR expression, yeast were pelleted by centrifugation, resuspended to an OD600=1.0 in SG-CAA (2% galactose, 0.67% yeast nitrogen base, 1% casamino acids), and incubated at 20EC for about 24 hr. In general, about 107 cells / tube were incubated on ice for 1 hr with 50 μl of QL9 / Ld / IgG dimers [Dal Porto et al. (1993) supra] diluted in phosphate buffered saline, pH 7.4 supplemented with 0.5 mg / ml BSA (PBS-BSA). After incubation, cells were washed and labeled for 30 min with FITC-conjugated goat anti-mouse IgG F(ab7)2 (Kirkegaard & Perry, Gaithersburg, Md.) in PBS-BSA. Yeast were then washed and resuspended in PBS-BSA immediately prior to sorting. Cells exhibiting the highest fluorescence were isolated by FACS sorting with a Coulter 753 bench. After ...

example 3

Soluble scTCR Production

[0091]The T7 and qL2 open reading frames were excised from pCT302 NheI-XhoI and ligated into NheI-XhoI digested pRSGALT, a yeast expression plasmid [Shusta et al. (1999) supra]. Ligated plasmids were transformed into DH10B electro-competent E. coli (Gibco BRL). Plasmid DNA was isolated from bacterial cultures and transformed into Saccharomyces cerevisiae BJ5464 (α ura3-52 trp1 leu2 1 his3 200 pep4:HIS3 prb1 1.6R can1 GAL) [Shusta et al. (1999) supra]. Yeast clones were grown in one liter SD-CAA / Trp (20 mg / L tryptophan) for 48 hr at 30EC. To induce scTCR secretion, cells were pelleted by centrifugation at 4000×g, resuspended in one liter SG-CAA / Trp supplemented with 1 mg / ml BSA, and incubated for 72 hr at 20EC. Culture supernatants were harvested by centrifugation at 4000×g, concentrated to about 50 ml, and dialyzed against PBS, pH 8.0. The 6His-tagged scTCRs were purified by native nickel affinity chromatography (Ni-NTA Superflow, Qiagen, Valencia, Calif.; 5 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

T cell receptors (TCRs) that have higher affinity for a ligand than wild type TCRs are provided. These high affinity TCRs are formed by mutagenizing a T cell receptor protein coding sequence to generate a variegated population of mutants of the T cell receptor protein coding sequence; transforming the T cell receptor mutant coding sequence into yeast cells; inducing expression of the T cell receptor mutant coding sequence on the surface of yeast cells; and selecting those cells expressing T cell receptor mutants that have higher affinity for the peptide / MHC ligand than the wild type T cell receptor protein. The high affinity TCRs can be used in place of an antibody or single chain antibody.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application is a continuation of U.S. application Ser. No. 12 / 494,458, filed Jun. 30, 2009, which is a divisional of U.S. application Ser. No. 10 / 783,786, filed Feb. 20, 2004, which is a divisional of U.S. application Ser. No. 09 / 731,242, filed Dec. 6, 2000, which is a continuation-in-part of U.S. application Ser. No. 09 / 009,388, filed Jan. 20, 1998, and which claims the benefit of U.S. Provisional Application No. 60 / 169,179, filed Dec. 6, 1999, all of which are hereby incorporated by reference.ACKNOWLEDGMENT OF FEDERAL RESEARCH SUPPORT[0002]This invention was made with Government support under Contract No. PHS-5-R01-GM55767-03 awarded by the National Institutes of Health (NIH). The Government has certain rights in this invention.BACKGROUND OF THE INVENTION[0003]The field of the present invention is molecular biology, in particular, as it is related to combinatorial libraries of immune cell receptors displayed on the cell surface of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C07K14/725C12N5/0783G01N33/569C12N5/08C12N15/10C40B40/02G01N33/68
CPCC12N15/1037C40B40/02G01N33/68G01N33/6842G01N33/6854G01N2333/39C07K14/7051C12N5/0636C12N2510/00G01N33/56972G01N2333/7051
Inventor KRANZ, DAVID M.WITTRUP, K. DANEHOLLER, PHILLIP D.
Owner THE BOARD OF TRUSTEES OF THE UNIV OF ILLINOIS