Unlock instant, AI-driven research and patent intelligence for your innovation.

Methods and kits for detection of nucleic acid molecules

a technology for nucleic acid molecules and kits, applied in the field of methods and kits for detection of nucleic acid molecules, can solve the problems of lack of cross-reactivity with other target-specific lamp primers, not all are simple enough to provide specific detection,

Pending Publication Date: 2020-08-06
LGC GENOMICS
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention provides a method for detecting polynucleotide amplification products using cassette oligonucleotides. These oligonucleotides have a fluorescence cassette-specific portion and a target-specific portion. The method involves providing a set of oligonucleotide primers, where each primer has a complementary sequence to the fluorescence cassette-specific portion of another primer in the set. The primers are designed to hybridize to the target polynucleotide and form an amplification product. The method also includes initiating an isothermal polynucleotide amplification reaction in the presence of a strand displacement DNA polymerase and detecting the signal generated. Kits for use in this method are also provided. The technical effect is a more sensitive and specific detection of polynucleotide amplification products.

Problems solved by technology

Although many amplification systems are currently in use, not all are simple enough to provide specific detection in a short time frame.
However, the selection of targets depends on the specificity of the complementary labelled oligonucleotide for the labelled target-specific LAMP primer, and a lack of cross-reactivity with other target-specific LAMP primers used in a multiplex reaction.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and kits for detection of nucleic acid molecules
  • Methods and kits for detection of nucleic acid molecules
  • Methods and kits for detection of nucleic acid molecules

Examples

Experimental program
Comparison scheme
Effect test

example 1

rial SNP Genotyping in a LAMP Reaction

[0095]As mitochondrial DNA is homozygous, individual samples possess only one allele of a SNP, allowing for detection of individual allele-specific amplification products in a multiplex reaction. A mitochondrial SNP genotyping assay (human mtDNA 11719) was used to demonstrate proof-of-concept for universal detection using a LAMP assay.

[0096]The mitochondrial DNA was extracted from human blood and the relevant target portion has the following DNA sequence, in which the SNP is shown in bold:

ACAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGG[A / G]CTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTC

[0097]Reverse (BIP) LAMP primers BIPKASP A / 1 and BIPKASP A / 2...

example 2

AMP Reaction for Mitochondrial SNP Genotyping

[0104]The mitochondrial SNP genotyping assay of Example 1 was repeated using a different strand-displacement DNA polymerase.

[0105]Primers, as described for Example 1, were combined into a bulk primer mix as follows:

TABLE 6Bulk primer mix.OligonucleotideStarting concentration Volume added161-6 FIP100 μM100 μl161-6 F3100 μM 25 μl161-6 B3100 μM 25 μl161-6 LF100 μM 50 μl161-6 LB100 μM 50 μl161-6100 μM 50 μlBIPKASP Al1 161-6100 μM 50 μlBIPKASP Al2Ultrapure waterNeat775 μl

[0106]A 20× cassette mix using the cassette oligonucleotide sequences described in Example 1 was made as follows:

TABLE 7Cassette mix.OligonucleotideStarting concentrationVolume addedFAM fluor500 μM 2.32 μlHEX fluor500 μM 2.32 μlFAM quencher500 μM 18.93 μlHEX quencher500 μM 18.93 μlTris / EDTA pH 8.310 mM Tris, 0.1 mM EDTA938.94 μl

[0107]Isothermal Master Mix was prepared as in Table 8 using Bst 3.0 DNA polymerase (NEB Cat # M0374) and accompanying reagents purchased from New Engl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Tm Aaaaaaaaaaa
Tm Aaaaaaaaaaa
Tmaaaaaaaaaa
Login to View More

Abstract

A method for the detection of one or more polynucleotide amplification products, the method comprising, in an embodiment, the steps of: a) providing one or more oligonucleotide primer groups, each group comprising: i) a forward primer comprising a fluorescence cassette-specific portion and a 3″ downstream target-specific portion; and ii) one or more target-specific primers; b) providing one or more fluorescent quenched pairs, each pair characterised by: i) a first cassette oligonucleotide labelled with a fluorescent moiety and having a sequence that is capable of hybridisation to the complement of the fluorescence cassette-specific portion of the forward primer of a given oligonucleotide primer group; and ii) a second cassette oligonucleotide labelled with a quencher moiety; c) initiating an isothermal polynucleotide amplification reaction in the presence of a strand displacement DNA polymerase thereby generating a complementary sequence to at least a portion of the relevant forward primer, such that the relevant second cassette oligonucleotide is less able to hybridise to the relevant first cassette oligonucleotide, whereby a signal is generated; and d) detecting the signal.

Description

FIELD OF THE INVENTION[0001]The present invention relates to methods and kits for detection of nucleic acid molecules, particularly polynucleotide amplification products formed in an isothermal polynucleotide amplification reaction.BACKGROUND OF THE INVENTION[0002]Sequence-specific isothermal nucleic acid amplification techniques offer advantages over traditional polymerase chain reaction (PCR), because they can provide rapid and sensitive molecular detection without the need for thermal cycling equipment as used in PCR. They may find particular utility in field or point-of-care molecular diagnostics due to their suitability for use with lower-powered and portable instrumentation.[0003]In contrast to PCR, which denatures double-stranded DNA (dsDNA) with heat, isothermal amplification methods typically use enzymatic activity to separate the strands of a target polynucleotide, and permit the hybridisation of sequence specific oligonucleotide primers. The amplification reaction is driv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/6818C12Q1/6844
CPCC12Q1/6818C12Q1/6844C12Q2527/143C12Q2531/119C12Q2565/101C12Q2565/107
Inventor HOWARD, REBECCA LOUISE
Owner LGC GENOMICS