Methods and kits for detection of nucleic acid molecules
a technology for nucleic acid molecules and kits, applied in the field of methods and kits for detection of nucleic acid molecules, can solve the problems of lack of cross-reactivity with other target-specific lamp primers, not all are simple enough to provide specific detection,
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
rial SNP Genotyping in a LAMP Reaction
[0095]As mitochondrial DNA is homozygous, individual samples possess only one allele of a SNP, allowing for detection of individual allele-specific amplification products in a multiplex reaction. A mitochondrial SNP genotyping assay (human mtDNA 11719) was used to demonstrate proof-of-concept for universal detection using a LAMP assay.
[0096]The mitochondrial DNA was extracted from human blood and the relevant target portion has the following DNA sequence, in which the SNP is shown in bold:
ACAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGG[A / G]CTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTC
[0097]Reverse (BIP) LAMP primers BIPKASP A / 1 and BIPKASP A / 2...
example 2
AMP Reaction for Mitochondrial SNP Genotyping
[0104]The mitochondrial SNP genotyping assay of Example 1 was repeated using a different strand-displacement DNA polymerase.
[0105]Primers, as described for Example 1, were combined into a bulk primer mix as follows:
TABLE 6Bulk primer mix.OligonucleotideStarting concentration Volume added161-6 FIP100 μM100 μl161-6 F3100 μM 25 μl161-6 B3100 μM 25 μl161-6 LF100 μM 50 μl161-6 LB100 μM 50 μl161-6100 μM 50 μlBIPKASP Al1 161-6100 μM 50 μlBIPKASP Al2Ultrapure waterNeat775 μl
[0106]A 20× cassette mix using the cassette oligonucleotide sequences described in Example 1 was made as follows:
TABLE 7Cassette mix.OligonucleotideStarting concentrationVolume addedFAM fluor500 μM 2.32 μlHEX fluor500 μM 2.32 μlFAM quencher500 μM 18.93 μlHEX quencher500 μM 18.93 μlTris / EDTA pH 8.310 mM Tris, 0.1 mM EDTA938.94 μl
[0107]Isothermal Master Mix was prepared as in Table 8 using Bst 3.0 DNA polymerase (NEB Cat # M0374) and accompanying reagents purchased from New Engl...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Tm A | aaaaa | aaaaa |
| Tm A | aaaaa | aaaaa |
| Tm | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


