Unlock instant, AI-driven research and patent intelligence for your innovation.

Human antibody and expression thereof

A fully human antibody and antibody technology, applied in the direction of antibodies, anti-tumor drugs, and the use of vectors to introduce foreign genetic material, etc.

Active Publication Date: 2007-10-24
SINO CELL TECH INC
View PDF2 Cites 39 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And the mouse-derived antibody may cause a strong HAMA immune response in humans

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human antibody and expression thereof
  • Human antibody and expression thereof
  • Human antibody and expression thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1. Construction of Human Antibody Library and Screening of Anti-EGFR scFv Antibody

[0032] (1) Construction of human antibody scFv antibody library

[0033] a)V Hgene, V L Amplification of Gene and Linker Peptide Fragments

[0034] The mixture of human lymph nodes, spleen and peripheral blood lymphocytes frozen in liquid nitrogen was ground in Trizol (Invitrogen), and total RNA was extracted according to the method on the instruction manual of Trizol. According to the instructions of Superscript II reverse transcriptase, 3 μg of total RNA was reverse-transcribed into the first strand of cDNA with 200U Superscript II reverse transcriptase (Invitrogen). These methods are well known to those skilled in the art.

[0035] The specific operations of molecular biology are methods well known to those skilled in the art (Samubrook J et al., "Molecular Cloning Experiment Guide", Beijing Science Press). According to the antibody heavy chain variable region (V H ), th...

Embodiment 2

[0072] Example 2. Preparation of human EGFR monoclonal complete IgG1 antibody gene

[0073] (1) Preparation of human kappa light chain constant region and human IgG1 heavy chain constant region

[0074] Collect 5ml of fresh human whole blood and centrifuge at 300g for 5min to pellet red blood cells and white blood cells. White blood cell RNA was extracted according to the operation protocol of the classical total RNA isolation kit manual of BBI Company. The leukocyte mRNA was reverse-transcribed into cDNA according to the operation protocol of the MMLV first strand cDNA synthesis kit manual of BBI Company.

[0075] PCR primers were designed based on known human kappa and IgG1 sequences. Using the reverse-transcribed cDNA as a template, the target gene was amplified by PCR.

[0076] Synthetic primer sequences:

[0077] L-F / BamH I: 5'GCG GGATCC CGTACGGTGGCTGCACCATCT 3' (SEQ ID NO: 22)

[0078] L-R / Xho I: 5'GCG CTCGAG CTAACACTCTCCCCTGTTGAAGCTC 3' (SEQ ID NO: 23)

[0079...

Embodiment 3

[0089] Example 3. Construction of high-efficiency expression vector for human EGFR monoclonal antibody

[0090] The human anti-EGFR monoclonal antibody gene can be expressed in multiple effective expression vectors, which all contain signal sequence, replication origin, one or more marker genes, enhancer sequence, promoter and transcription termination sequence. The present invention uses commercial pIRESneo3 (Clontech) as the basis to weaken the neo marker gene, thereby screening cell clones with high expression of human anti-EGFR monoclonal antibody.

[0091] Using conventional molecular biology techniques well known to those skilled in the art, the heavy chains of N2-1, N5-4, N6-3, and N8-3 were inserted into the mammalian expression vector pIRESneo3d prepared by our company (by inserting dhfr in pIRESneo3) Gene expression cassette) in the multiple cloning site region. The specific operation is that pIRESneo3d is double digested with EcoR V and BamH I (TaKaRa), and the enz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a full-human anti-EGFR scFv antibody segment and entire antibody, which contains heavy chain of antibody and nucleic acid and amino acid of variable area of light chain as well as high-effective expressing method of entire antibody in the CHO cell.

Description

field of invention [0001] The present invention relates to a new anti-epidermal growth factor receptor (EGFR) human antibody series, which can treat and prevent EGFR-related diseases with a small dose. The present invention also relates to a method for producing the antibody in CHO cells using gene recombination technology. Background of the invention [0002] Epidermal growth factor receptor (EGFR) is a member of the erbB family, which contains four related cell membrane receptors, including EGFR (Her 1 or erbB1), erbB2 (Her2), erbB3 (Her3) and erbB4 (Her4). All proteins in this family are transmembrane glycoproteins, which contain an extracellular ligand binding region and an intracellular tyrosine kinase active region with signal transduction function. EGFR is an approximately 170kD transmembrane glycoprotein that enables the expansion and differentiation of many types of cells. EGFR has been shown to be overexpressed in many types of human soli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/46A61K39/395A61P35/00C12N15/13C12N15/63C12N15/85
Inventor 孙春昀李因传康平
Owner SINO CELL TECH INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More