Human antibody and expression thereof
A fully human antibody and antibody technology, applied in the direction of antibodies, anti-tumor drugs, and the use of vectors to introduce foreign genetic material, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1. Construction of Human Antibody Library and Screening of Anti-EGFR scFv Antibody
[0032] (1) Construction of human antibody scFv antibody library
[0033] a)V Hgene, V L Amplification of Gene and Linker Peptide Fragments
[0034] The mixture of human lymph nodes, spleen and peripheral blood lymphocytes frozen in liquid nitrogen was ground in Trizol (Invitrogen), and total RNA was extracted according to the method on the instruction manual of Trizol. According to the instructions of Superscript II reverse transcriptase, 3 μg of total RNA was reverse-transcribed into the first strand of cDNA with 200U Superscript II reverse transcriptase (Invitrogen). These methods are well known to those skilled in the art.
[0035] The specific operations of molecular biology are methods well known to those skilled in the art (Samubrook J et al., "Molecular Cloning Experiment Guide", Beijing Science Press). According to the antibody heavy chain variable region (V H ), th...
Embodiment 2
[0072] Example 2. Preparation of human EGFR monoclonal complete IgG1 antibody gene
[0073] (1) Preparation of human kappa light chain constant region and human IgG1 heavy chain constant region
[0074] Collect 5ml of fresh human whole blood and centrifuge at 300g for 5min to pellet red blood cells and white blood cells. White blood cell RNA was extracted according to the operation protocol of the classical total RNA isolation kit manual of BBI Company. The leukocyte mRNA was reverse-transcribed into cDNA according to the operation protocol of the MMLV first strand cDNA synthesis kit manual of BBI Company.
[0075] PCR primers were designed based on known human kappa and IgG1 sequences. Using the reverse-transcribed cDNA as a template, the target gene was amplified by PCR.
[0076] Synthetic primer sequences:
[0077] L-F / BamH I: 5'GCG GGATCC CGTACGGTGGCTGCACCATCT 3' (SEQ ID NO: 22)
[0078] L-R / Xho I: 5'GCG CTCGAG CTAACACTCTCCCCTGTTGAAGCTC 3' (SEQ ID NO: 23)
[0079...
Embodiment 3
[0089] Example 3. Construction of high-efficiency expression vector for human EGFR monoclonal antibody
[0090] The human anti-EGFR monoclonal antibody gene can be expressed in multiple effective expression vectors, which all contain signal sequence, replication origin, one or more marker genes, enhancer sequence, promoter and transcription termination sequence. The present invention uses commercial pIRESneo3 (Clontech) as the basis to weaken the neo marker gene, thereby screening cell clones with high expression of human anti-EGFR monoclonal antibody.
[0091] Using conventional molecular biology techniques well known to those skilled in the art, the heavy chains of N2-1, N5-4, N6-3, and N8-3 were inserted into the mammalian expression vector pIRESneo3d prepared by our company (by inserting dhfr in pIRESneo3) Gene expression cassette) in the multiple cloning site region. The specific operation is that pIRESneo3d is double digested with EcoR V and BamH I (TaKaRa), and the enz...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
