Diagnosis use for chronic medullary system leukemia IFN-alpha-resistant marker gene
A myeloid leukemia and marker gene technology, which is applied in the field of diagnosis of chronic myeloid leukemia resistance IFN-α marker gene, and can solve the problem of inability to detect interferon resistance and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: RT-PCR is used to verify the expression difference of GSTP1 gene in KT-1 / A3 and KT-1 / A3R cells
[0024] Human chronic myeloid leukemia cell lines KT-1 / A3 and KT-1 / A3R were donated by Professor Ikuya Sakai of Ehime University, Japan.
[0025] 1. Primer design
[0026] The cDNA sequences of the GSTP1 gene (accession number: NM_000852) and the internal reference β-actin gene (accession number: NM_001101) were found in GeneBank, and the amplification primers were designed with Primer 5 software. The sequences are as follows:
[0027] GSTP1-F: 5'GCCCTACACCGTGGTCTATT 3'
[0028] GSTP1-R: 5′ GACGCAGGATGGTATTGGA 3′
[0029] β-actin-F: 5′GTGGACATCCGCAAAGAC 3′
[0030] β-actin-R: 5′AAAGGGTGTAACGCAACTAA 3′
[0031] The primers were synthesized by Shanghai Sangon Company, and the sizes of the amplified products were 302 bp (β-actin) and 209 bp (GSTP1), respectively, and the products all spanned more than one intron in the genomic DNA sequence.
[0032] 2. Cell cultu...
Embodiment 2
[0060] Example 2: Using Western blotting to verify the difference in the expression of GST pi protein in KT-1 / A3 and KT-1 / A3R cells
[0061] 1. Cell preparation: make the density 2×10 5 cells / ml of KT-1 / A3, KT-1 / A3R cells in 2 flasks each, placed at 37°C, 5% CO 2 Cultured in the incubator for 48hr.
[0062] 2. Preparation of protein samples
[0063] 1) Pour the culture solution into a 15ml centrifuge tube and centrifuge at 2500g for 5min.
[0064] 2) Discard the supernatant, add 5ml of PBS, shake gently and centrifuge at 2500g for 5min, discard the supernatant, wash and centrifuge once with PBS repeatedly.
[0065] 3) Add 400 μl RIPA lysate (50mM Tris-HCl, pH7.4; 150mM NaCl; 1mM EDTA; 1% Triton X-100; 1% sodium deoxycholate; 0.1% SDS) to suspend the cell pellet and transfer to a 1.5ml centrifuge tube , the protease inhibitor PMSF (100 mM stock solution prepared with isoamyl alcohol, stored at -20°C) was added to a final concentration of 1 mM, and lysed in an ice bath for ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com