Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method of leptospira

A leptospira and detection method technology, applied in the fields of clinical medicine, biochemistry and molecular biology, can solve problems such as hindering large-scale popularization and use, high-cost detection, exogenous nucleic acid pollution, etc., and achieve easy application and promotion, The effect of fast detection speed and simple detection equipment

Inactive Publication Date: 2008-07-23
ZHEJIANG UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the PCR method is easy to cause non-specific amplification in practical application, and it is also very easy to be polluted by other exogenous nucleic acids in the environment before and after the experiment, so it often causes false positive or false negative phenomena in the experimental results, which greatly limits the technology. Application in clinical testing
Although real-time fluorescence quantitative PCR has greatly improved in technology and can quantify the detection samples, its expensive equipment and high-cost detection hinder the large-scale promotion and use of this technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of leptospira
  • Detection method of leptospira

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] The nucleic acid detection method of Leptospira is to use specific primers to amplify specific regions of the target gene using the LAMP technology platform. With the aid of positive and negative control and internal reference detection systems, nucleic acid screening of Leptospira is carried out at the molecular level. Check or test;

[0042] Specific steps are as follows:

[0043] 1) Design specific primers for LAMP reaction according to the sequence of Leptospira LipL41 gene as shown in the table;

[0044] Edit Name Sequence Length

[0045] Number degree

[0046] F3 ATTGGAGCGGAAGCAATT 18

[0047] B3 GGAATTAACATCATACGTACTCC 23

[0048] 01 FIP CCAGCTGCAACYGCATCGATGGTTACCAAAAACCTTATACAGAG 44

[0049] BIP GCAGGTTTCGCCGCTTCTATAGGTTTAGATACTGGTTCGTTTC 43

[0050] Loop B GGCAACTGGTAAAGACGTAAATACA 25

[0051] F3 GTAAATACAGGAAACGAACCA 21

[0052] B3 RCCCTTGATATAAGCAGCA 19

[0053] FIP CGCTTTTTTTACTTCCCCAGTTTCTATCTAAACCTACTGGAGTACG 46

[0054] 02

[0055] BI...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detecting method for leptospira, which is based on the quantitative detection technique of nucleic acid isothermal expansion, which is characterized in that a specific primer is used, and the specific area of target gene is expanded utilizing the LAMP technological platform; under the assistance of a series of quality control and internal control detection system, the leptospira is detected in molecule level, which can realize the qualitative and quantitative detection to micro sample. Compared with the prior art, the detecting method for leptospira has the advantages of decreased non-specific expansion because of isothermal expansion, good specificity, fast detection speed, high sensitivity, no need for special equipment, low cost, easy operation, easy popularization and wide application prospect, and is suitable for experimental study, clinical detection and environment detection.

Description

Technical field [0001] The invention belongs to the technical fields of clinical medicine and biochemistry and molecular biology, and specifically relates to a method for detecting Leptospira. Background technique [0002] Leptospirosis is a severe acute infectious disease with a global epidemic and a typical zoonotic disease. Many provinces and cities in my country have found sick or sick animals and animals with bacteria, and more than 60 kinds of animals have been detected. The disease mostly occurs in summer and autumn rainy seasons, the disease is rapid, and the infection method and clinical manifestations are complicated due to different serotypes of infection. [0003] The clinical symptoms of leptospirosis are complex. And lack of specific symptoms, difficult to diagnose, especially in the early stages of illness. Delays in treatment due to misdiagnosis and delayed treatment have been reported from time to time. Therefore, pathogenic detection and rapid diagnosis of Lepto...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCY02A50/30
Inventor 林旭瑷陈寅卢亦愚严菊英严杰
Owner ZHEJIANG UNIV