Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular mark, detecting method and application of mushroom cultivation strain

A molecular marker and detection method technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as affecting the enthusiasm of cultivation, the loss of mushroom farmers, and affecting the rapid development of shiitake mushrooms.

Inactive Publication Date: 2008-09-17
SHANGHAI ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As far as the country is concerned, the phenomenon of "same species with different names and different species with the same name" in the cultivation of shiitake mushrooms has not only brought great losses to mushroom farmers, but also affected their enthusiasm for cultivation, and also greatly affected the rapid development of shiitake mushrooms in China. and, along with the appearance of large-scale industrialized cultivation methods, the requirements for the quality of the cultivated strains of shiitake mushrooms are getting higher and higher, and it is necessary to develop a more simple, fast and accurate strain identification technology to ensure that each batch of species is used. accurate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular mark, detecting method and application of mushroom cultivation strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Mycelia culture

[0036] The shiitake mushroom strains preserved at 4°C were transferred to PDA plates and cultured at 25°C in the dark. After 14 days, they were placed in 100 mL PDY medium, 150 rpm, and cultured in shake flasks at 25°C. When the mycelia grow to a certain amount, the mycelia are collected and put into a -20°C refrigerator for freezing.

[0037] 2. Genomic DNA extraction

[0038] Genomic DNA was extracted using a modified CTAB method. The concentration and purity of the total genomic DNA were detected by ultraviolet spectrophotometry, the concentration of the sample DNA was adjusted to be consistent, and the samples were refrigerated for later use.

[0039] 3. Detection of SCAR molecular markers

[0040] Amplification system (total volume 25μL): 10×PCR buffer 2.5μL, 25mmol / L MgCL 2 2μL, 10mmol / LdNTP 0.25L, 2.5U / μL Taq DNase 0.5μL, 10μmol / L 241-4F / R 1μL each, template DNA 1μL (concentration 1ng~10ng / μL), ddH 2O 18.6 μL. PCR reaction conditions:...

Embodiment 2

[0045] Using 241-4 specific primers, SCAR amplification was carried out on 114 strains of shiitake mushrooms collected from all over the country and a few wild species. Six of the 114 strains amplified the 241-4 SCAR marker, four of which were 241-4 strains collected from different places, and the other two were from Zhenzhou Edible Fungi Research Institute, Qingyuan County, Zhejiang Province. Wangyou 12 from the Institute and Shifeng 1 from the Agricultural Technology Extension Station of Xinyang City, Henan Province.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular mark of mushroom cultivation strains 241-4, a detecting method and the application thereof. The molecular mark is a molecular specific detecting mark of gene SCAR, and a PCR special primer pair thereof has the sequence that 241-4F:5<1>CTCTGGTCATTGTTACTGTG 3<1> and 241-4R:5<1>CTCTGGCAAGGCTTAT 3<1>. The detecting method comprises the steps that are (1) mycelium culture, (2) the extraction of genome DNA, (3) the detection of the SCAR molecular mark, and (4) electrophoresis detection. The method has the application that the gene SCAR in mushroom strains is expanded, and the mushroom strains with SCAR marks are the mushroom cultivation strains 241-4. Compared with the conventional morphological detection, an antagonism test and a fruiting test, the molecular mark, the detecting method and the application thereof have the advantages of short detecting time and high accuracy; the detecting method has specificity of 241-4 strains in the thirty collected major mushroom strains in China.

Description

technical field [0001] The invention belongs to the detection field of mushroom cultivars, and in particular relates to a molecular marker of mushroom cultivar 241-4, a detection method and an application thereof. Background technique [0002] The output of shiitake mushrooms in my country has grown rapidly from 19,500 tons in 1983 to 2.42 million tons in 2005, accounting for more than 70% of the total output of shiitake mushrooms in the world. Some experts predict that due to the rapid development of China's shiitake mushroom industry, it will become the edible fungus with the highest output in the world in the past 10 years. Chinese shiitake mushrooms have attracted the attention of people in the world's mushroom industry for their astonishing development speed, high-quality quality and low cost. Chinese shiitake mushrooms have become popular all over the world. [0003] The contribution rate of high-quality strains to the yield and quality of shiitake mushrooms is very im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/04C12Q1/68C12N15/11
Inventor 宋春艳谭琦尚晓冬陈明杰
Owner SHANGHAI ACAD OF AGRI SCI