Supercharge Your Innovation With Domain-Expert AI Agents!

Calcitonin-gene-related peptide and trout calcitonin amalgamation polypeptide transgenic sequence, and transgenic engineering bacterial strain

A technology of salmon calcitonin and transgene engineering, which is applied in the field of fusion polypeptide transgene sequences and transgene engineering strains, can solve the problems of being unsuitable for industrial production, and achieve low-cost and effective field planting, easy large-scale production, and convenient storage and transportation. Effect

Inactive Publication Date: 2008-12-10
HEILONGJIANG UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the problem that the current calcitonin gene-related peptide and salmon calcitonin fusion polypeptide are not suitable for industrial production using microorganisms and animals as reactors, and provide a calcitonin gene-related peptide and salmon calcitonin fusion polypeptide Calcitonin Fusion Polypeptide Transgene Sequence and Transgenic Engineering Strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Calcitonin-gene-related peptide and trout calcitonin amalgamation polypeptide transgenic sequence, and transgenic engineering bacterial strain
  • Calcitonin-gene-related peptide and trout calcitonin amalgamation polypeptide transgenic sequence, and transgenic engineering bacterial strain
  • Calcitonin-gene-related peptide and trout calcitonin amalgamation polypeptide transgenic sequence, and transgenic engineering bacterial strain

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0016] Specific embodiment one: In this embodiment, the calcitonin gene-related peptide and salmon calcitonin fusion polypeptide transgene sequence is as follows:

[0017] TCCCCCGGG GTTTTTATTTTTAATTTTCTTTCA AATACTTCCATC ATGCATCATCATCATCATCATCATATGGCTTGCGATACTGCTACTTGCGTTACTCATAGACTTGCTGGACTTCTTTCTAGATCTGGAGGAGTTGTTAAGAATAATTTTGTTCCAACTAATGTTGGATCTAAGGCTTTTGGTACCTGCTCTAATCTTTCTACTTGCGGACTTGGAAAGCTTTCTCAAGAAGCTCATAAGCTTCAAACTCCAGAACTGATACTGCAGCGGAACTA.

[0018] In this embodiment, the calcitonin gene-related peptide and salmon calcitonin fusion polypeptide transgene sequence was synthesized by Nanjing Jitian Co., Ltd.

[0019] In this embodiment, the calcitonin gene-related peptide and salmon calcitonin fusion polypeptide transgene sequence is designed according to the codon preferred by tomato; in order to enhance the effect of the promoter CaMV 35S, an AMV sequence (underlined part of the gene sequence) is designed before the fusion gene .

[0020] Since tomato is selected ...

specific Embodiment approach 2

[0024] Embodiment 2: In this embodiment, the calcitonin gene-related peptide and salmon calcitonin fusion polypeptide transgenic engineering strain is an Agrobacterium containing a fusion gene plasmid, wherein the fusion gene in the plasmid is shown in SEQ ID NO:1.

[0025] In this embodiment, the calcitonin gene-related peptide and salmon calcitonin fusion polypeptide transgenic engineering strain is a Gram-negative bacterium, a spore-free Brevibacterium, with a bacterial width of 0.6-1.0 μm and a bacterial length of 1.5-3.0 μm. 6 perinatal or lateral flagella move, aerobic, and the metabolism is respiratory type. The optimum growth temperature is 25-28°C, and the optimum pH is pH6.0; the colonies are usually round, raised, smooth, white to off-white, Translucent, rifampin-resistant and kanamycin-resistant.

[0026] In this embodiment, the gene sequence shown in SEQ ID NO: 1 is cloned into the pUC57 vector, the fusion gene is recovered by Sac I and Sma I double enzyme digesti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion polypeptide transgene sequence for calcitonin-gene-related peptide and salmon calcitonin and a transgene engineering strain thereof, and relates to a fusion polypeptide transgene sequence and a transgene engineering strain. The invention solves the problem that: the prior calcitonin-gene-related peptide and salmon calcitonin fusion polypeptide are not suitable for industrialized production with microbes and animals as reactors. The calcitonin-gene-related peptide and salmon calcitonin fusion polypeptide transgene sequence is shown as SEQ ID NO.1. The calcitonin-gene-related peptide and salmon calcitonin fusion polypeptide transgene engineering strain is an agrobacterium containing fusion gene plasmids, wherein the fusion genes in the plasmids are shown as SEQ ID NO.1. The calcitonin-gene-related peptide and salmon calcitonin fusion polypeptide transgene engineering strain can be used for mediating a plant with the cost of the engineering strain being 1 / 10 to 1 / 50 of that of bacillus coli.

Description

technical field [0001] The invention relates to a fusion polypeptide transgene sequence and a transgene engineering strain. Background technique [0002] Calcitonin gene-related peptide and salmon calcitonin fusion polypeptide (as shown in SEQ ID NO: 3) have the respective enzymatic activities of calcitonin gene-related peptide and salmon calcitonin; and the coupling reaction produces reduced nicotinamide glands The speed of purine dinucleotide (NADH) is more than twice the reaction speed of the reaction system adding two single (calcitonin gene-related peptide and salmon calcitonin) polypeptides at the same time, and the transition time is greatly shortened , shortened to about 1 / 4 of the original transition state time and many other advantages. [0003] For industrial production, microorganisms and animals are currently used as reactors, but there are the following problems in using microorganisms and animals as reactors: ① Bacteria cannot produce complete antibodies, nor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N1/21C12R1/01
Inventor 余琼
Owner HEILONGJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More