Constant temperature nucleic acid amplification fast detecting reagent kit for bacillus coli O157 and use method thereof

A detection kit, the technology of Escherichia coli, is applied in the field of Escherichia coli O157 constant temperature nucleic acid amplification rapid detection kits, and can solve the problems of difficult fluorescently labeled antibodies, cell damage, false positive results, etc.

Inactive Publication Date: 2009-01-14
SOUTH CHINA UNIV OF TECH
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in situ PCR has many disadvantages: (1) cells in the amplified product are damaged due to permeabilization and thermal cycling, which makes it difficult for us to use fluorescently labeled antibodies for simultaneous cell recognition; (2) ) The impermeability of the cell wall and the interference in the PCR amplification reaction caused by DNA polymerase inhibitors can produce false negative results; results, or positive results from nonspecifically bound labeled nucleotides through nick translation activity, can cause false positive results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Configure Escherichia coli O157 constant temperature gene amplification rapid detection kit according to the following formula:

[0050] Primer mixture: the concentration of the four primers in the mixture is 10 pmol / μl, and the primer sequences are as follows:

[0051] Outer primer 1: GCTATACCACGTTACAGCGTG;

[0052] Outer primer 2: ACTACTCAACCTTCCCCAGTTC;

[0053] Internal primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTCTTATCTGG;

[0054] Inner Primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC

[0055] Phosphate buffer PBS: 137mM NaCl, 2.7mM KCl, 8.1mM NaCl 2 HPO 4 , pH7.0, 1.5mM KH 2 PO 4 ;

[0056] Paraformaldehyde: 2% by mass;

[0057] Polylysine: 0.03% by mass;

[0058] Lysozyme: the concentration is 0.6mg / ml;

[0059] Proteinase K: the concentration is 0.1mg / ml;

[0060] RNase: the concentration is 1mg / ml;

[0061] Bst DNA polymerase: the concentration is 8U / μl;

[0062] Reaction buffer: 80μl 10mM dNTP, 50μl 10×ThemoPol Buffer, 20μl 150mM MgSO 4 ; ...

Embodiment 2

[0084] Configure Escherichia coli O157 constant temperature gene amplification rapid detection kit according to the following formula:

[0085] Primer mixture: the concentration of the four primers in the mixture is 10 pmol / μl, and the primer sequences are as follows:

[0086] Outer primer 1: GCTATACCACGTTACAGCGTG;

[0087] Outer primer 2: ACTACTCAACCTTCCCCAGTTC;

[0088] Internal primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTCTTATCTGG;

[0089] Inner primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC;

[0090] Phosphate buffer PBS: 137mM NaCl, 2.7mM KCl, 8.1mM NaCl 2 HPO 4 , pH7.2, 1.5mM KH 2 PO 4 ;

[0091] Paraformaldehyde: 3% by mass;

[0092] Polylysine: 0.04% by mass;

[0093] Lysozyme: the concentration is 0.7mg / ml;

[0094] Proteinase K: the concentration is 0.2mg / ml;

[0095] RNase: the concentration is 1mg / ml;

[0096] Bst DNA polymerase: the concentration is 8U / μl;

[0097] Reaction buffer: 80μl 10mM dNTP, 50μl 10×ThemoPol Buffer, 20μl 150mM MgSO 4 ...

Embodiment 3

[0119] Configure Escherichia coli O157 constant temperature gene amplification rapid detection kit according to the following formula:

[0120] Primer mixture: the concentration of the four primers in the mixture is 10 pmol / μl, and the primer sequences are as follows:

[0121]Outer primer 1: GCTATACCACGTTACAGCGTG;

[0122] Outer primer 2: ACTACTCAACCTTCCCCAGTTC;

[0123] Internal primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTCTTATCTGG;

[0124] Inner primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC;

[0125] Phosphate buffer PBS: 137mM NaCl, 2.7mM KCl, 8.1mM NaCl 2 HPO 4 , pH 8, 1.5mM KH 2 PO 4 ;

[0126] Paraformaldehyde: 4% by mass;

[0127] Polylysine: 0.05% by mass;

[0128] Lysozyme solution: the concentration is 0.8mg / ml;

[0129] Proteinase K: the concentration is 0.3mg / ml;

[0130] RNase: the concentration is 2mg / ml;

[0131] Bst DNA polymerase: the concentration is 8U / μl;

[0132] Reaction buffer: 80μl 10mM dNTP, 50μl 10×ThemoPol Buffer, 20μl 150mM M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an escherichia coli O157 mediated isothermal nucleic acid amplification rapid detecting kit and a use method thereof. The kit comprises a primer mixed liquor, which adopts the sequence: an outer primer 1: GCTATACCACGTTACAGCGTG, an outer primer 2: ACTACTC AACCTTCCCCAGTTC, an inner primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTC TTATCTGG, an inner primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC, a phosphate buffer solution PBS, paraformaldehyde, polylysine, lysozyme, proteinase K, RNase, BstDNA polymerase, a reaction solution, a sample pretreatment solution, a chromogenic agent, positive control and negative control. Highly specific, rapid, efficient and sensitive and simple situ detection for escherichia coli O157 can be realized through the escherichia coli O157 immobilized processing, cell permeability processing, mediated isothermal amplification for genes, and determining the results of the reaction products by using the kit.

Description

technical field [0001] The invention relates to a constant temperature nucleic acid amplification detection method, in particular to a rapid detection kit for Escherichia coli O157 constant temperature nucleic acid amplification and its usage. Background technique [0002] Enterohemorrhagic Escherichia coli (EHEC) O157 is an important zoonotic pathogen. It is mainly transmitted through food and water sources. The disease can cause diarrhea, hemorrhagic enteritis, secondary hemolytic uremic syndrome (HUS), thrombosis thrombocytopenic purpura (TTP) and so on. The condition of HUS and TTP is dangerous, and the case fatality rate is high. Since the bacteria was first isolated in the United States in 1982, there have been reports of distribution and outbreaks around the world. In recent years, more than ten provinces in my country have successively detected the pathogenic bacteria in food, poultry, livestock, insects and patients with diarrheal diseases, and there is a potentia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/10
Inventor石磊王秋艳黄帆常彦磊李琳
OwnerSOUTH CHINA UNIV OF TECH