Supercharge Your Innovation With Domain-Expert AI Agents!

Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof

A technology of RT-LAMP and respiratory syndrome, applied in the field of veterinary biological products, can solve the problems of long cycle, cumbersome operation, unsuitable for antigen detection, etc.

Active Publication Date: 2009-11-11
CHINA INST OF VETERINARY DRUG CONTROL
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the actual PRRSV detection work, the detection techniques used have the following problems: common PCR method: prone to false positives, high requirements for template quality; common serological method: insufficient sensitivity, cumbersome operation, not suitable More demanding antigen detection work; cell isolation and culture identification: long cycle and harsh experimental conditions
At present, there are no RT-LAMP kits for detecting porcine reproductive and respiratory syndrome virus and the application of LAMP method in the detection of porcine reproductive and respiratory syndrome virus at home and abroad. Report on a LAMP detection method for effective differentiation of highly pathogenic PRRSV (NSP2-mutated American PRRSV) strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof
  • Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof
  • Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] PRRSV RT-LAMP Primer Design and Screening

[0097] According to the gene sequences of the classic PRRSV (American strain VR-2332), other 4 American strains and NSP2 mutated American PRRSV strains (highly pathogenic PRRS GD strain, Beijing strain) published by GenBank as templates, Design RT-LAMP detection primers on both sides of the 90bp nucleotide sequence missing in the NSP2 variant region of highly pathogenic PRRS virus, use LAMP Tubidimeter to screen the results of different primers, and select 2 pairs of sequences as shown below Primers:

[0098] F3: CAGATCCGATTGCGGCAG

[0099] B3: TTCTACGCGGTGCAGGAA

[0100] FIP: CATCGGCTCGGATGGTGTCGATGGGCGACAATGTCCCTA

[0101] BIP: ACCCATGAGTGAGCCCGTACTCGACCCACTCAAAGGTTTCA

[0102] And determine the ratio of the above primers in each component of the primer mixture (PrimerMix, PM):

[0103] 100pmol / μl F3 2.5μl, 100pmol / μl B3 2.5μl, 100pmol / μl FIP 20μl, 100pmol / μl BIP 20μl were mixed, then added 5μl of sterilized deionized w...

Embodiment 2

[0105] Preparation of components in the kit:

[0106] According to the formula (50 reaction volumes) of the following components, the various components are formulated and distributed into small glass or plastic containers and sealed with corresponding stoppers:

[0107] 1. LBBII-RNA, this reagent group consists of four parts: RA, RB, RC, and RD:

[0108] RA: Dissolve 0.6ml of 1% 2-mercaptoethanol, 0.6ml of pH 8.0 1% Tris-HCL, and 1ml of 10mmol / ml EDTA in 5.0ml of sterilized double-distilled water.

[0109] RB: 35ml of 6mmol / ml guanidine isothiocyanate.

[0110] RC: absolute ethanol 15ml.

[0111] RD: 100u / μl DNAse A 20μl dissolved in 10ml DEPC H 2 O,

[0112] 2. LAMP reaction reagent

[0113] 1) PM: Mix 2.5 μl 100 pmol / μl F3, 2.5 μl 100 pmol / μl B3, 20 μl 100 pmol / μl FIP, 20 μl 100 pmol / μl FIP, add 5 μl of sterilized deionized water, the total system is 50 μl. Take 1 μl PB for each reaction.

[0114] 2) RM: Take 50 μl of 4mmol / μl magnesium sulfate, 50 μl of 1.6mol / μl be...

Embodiment 3

[0119] Use of PPRSV RT-LAMP Kit

[0120] 1. Use LBBII-RNA to extract sample RNA

[0121] Take 100 μl of cell culture (or serum, tissue grinding sample), after repeated freezing and thawing 3 times, follow the steps below:

[0122] Add an equal volume of RA to the sample, vortex for 15s, centrifuge at 12,000g for 1min, take the supernatant and put it in a small tube; add 3 times the RB solution to the supernatant, vortex or vigorously shake for 90s, and let it stand for 3min; add 1 / 3 volumes of RC solution, vortexed for 1 min, and centrifuged at 12000 g for 1 min. Discard the supernatant; after the sample is dry, add 11 μl RD to dissolve the precipitate, which is the sample RNA.

[0123] 2. PRSSV RT-LAMP reaction

[0124] ① Prepare RT-LAMP reaction solution: add 12.5 μl of RM, 1.0 μl of EM, and 1.0 μl of PM into the reaction tube;

[0125] ② Take 5.5 μl sample RNA and add it to the tube of the reaction solution prepared in item ①;

[0126] ③ After mixing, place the reacti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and a detection method thereof. Primers required by PRSSV RT-LAMP reaction system are designed according to the sequence of porcine reproductive and respiratory syndrome virus (PRSSV) published by GenBank; PRSSV virus RNA is extracted with the virus RNA extraction reagent (LBBII-RNA) designed and prepared by the inventor, the PRSSV RT-LAMP reaction system established in the invention is utilized for detection, and color developing agent is added after the reaction to judge the result; the result shows that the PRSSV virus RNA obtains efficient specific amplification after the reaction is conducted for 45 minutes at the temperature of 63 DEG C; and then, quick detection of porcine reproductive and respiratory syndrome virus American classical strain and NSP2 variant strain (highly pathogenic porcine reproductive and respiratory syndrome virus strain) is conducted by SpuI enzyme cutting. Compared with the prior art, the invention has quick detection, high sensitivity, low reaction cost, convenient and fast operation, which is capable of differentiating American classical strain and NSP2 variant strain (highly pathogenic porcine reproductive and respiratory syndrome virus strain) and meets the requirement of multi-level detection.

Description

technical field [0001] The invention relates to a porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and a detection method thereof, belonging to the disease diagnosis technology in the field of veterinary biological products. Background technique [0002] Porcine Reproductive and Respiratory Syndrome, also known as PRRS, is an infectious disease characterized by reproductive disorders in sows and respiratory diseases in piglets caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). Infectious diseases that pose a greater threat to the pig industry. [0003] PRRSV belongs to the nestoviridae and Arteriviridae. This enveloped virus is a positive-sense single-stranded RNA virus, and its gene length is 15kb. The current PRRSV virus strains prevalent in China are the American type and the NSP2 mutated American type PRRSV strain (highly pathogenic PRRSV strain). At present, the detection methods of the virus include RT-PCR method, cell se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68G01N21/78G01N27/447C12R1/93
Inventor 宁宜宝刘业兵张磊陈坚
Owner CHINA INST OF VETERINARY DRUG CONTROL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More