Porcine reproductive and respiratory syndrome virus RT-LAMP detection kit and detection method thereof
A technology of RT-LAMP and respiratory syndrome, applied in the field of veterinary biological products, can solve the problems of long cycle, cumbersome operation, unsuitable for antigen detection, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] PRRSV RT-LAMP Primer Design and Screening
[0097] According to the gene sequences of the classic PRRSV (American strain VR-2332), other 4 American strains and NSP2 mutated American PRRSV strains (highly pathogenic PRRS GD strain, Beijing strain) published by GenBank as templates, Design RT-LAMP detection primers on both sides of the 90bp nucleotide sequence missing in the NSP2 variant region of highly pathogenic PRRS virus, use LAMP Tubidimeter to screen the results of different primers, and select 2 pairs of sequences as shown below Primers:
[0098] F3: CAGATCCGATTGCGGCAG
[0099] B3: TTCTACGCGGTGCAGGAA
[0100] FIP: CATCGGCTCGGATGGTGTCGATGGGCGACAATGTCCCTA
[0101] BIP: ACCCATGAGTGAGCCCGTACTCGACCCACTCAAAGGTTTCA
[0102] And determine the ratio of the above primers in each component of the primer mixture (PrimerMix, PM):
[0103] 100pmol / μl F3 2.5μl, 100pmol / μl B3 2.5μl, 100pmol / μl FIP 20μl, 100pmol / μl BIP 20μl were mixed, then added 5μl of sterilized deionized w...
Embodiment 2
[0105] Preparation of components in the kit:
[0106] According to the formula (50 reaction volumes) of the following components, the various components are formulated and distributed into small glass or plastic containers and sealed with corresponding stoppers:
[0107] 1. LBBII-RNA, this reagent group consists of four parts: RA, RB, RC, and RD:
[0108] RA: Dissolve 0.6ml of 1% 2-mercaptoethanol, 0.6ml of pH 8.0 1% Tris-HCL, and 1ml of 10mmol / ml EDTA in 5.0ml of sterilized double-distilled water.
[0109] RB: 35ml of 6mmol / ml guanidine isothiocyanate.
[0110] RC: absolute ethanol 15ml.
[0111] RD: 100u / μl DNAse A 20μl dissolved in 10ml DEPC H 2 O,
[0112] 2. LAMP reaction reagent
[0113] 1) PM: Mix 2.5 μl 100 pmol / μl F3, 2.5 μl 100 pmol / μl B3, 20 μl 100 pmol / μl FIP, 20 μl 100 pmol / μl FIP, add 5 μl of sterilized deionized water, the total system is 50 μl. Take 1 μl PB for each reaction.
[0114] 2) RM: Take 50 μl of 4mmol / μl magnesium sulfate, 50 μl of 1.6mol / μl be...
Embodiment 3
[0119] Use of PPRSV RT-LAMP Kit
[0120] 1. Use LBBII-RNA to extract sample RNA
[0121] Take 100 μl of cell culture (or serum, tissue grinding sample), after repeated freezing and thawing 3 times, follow the steps below:
[0122] Add an equal volume of RA to the sample, vortex for 15s, centrifuge at 12,000g for 1min, take the supernatant and put it in a small tube; add 3 times the RB solution to the supernatant, vortex or vigorously shake for 90s, and let it stand for 3min; add 1 / 3 volumes of RC solution, vortexed for 1 min, and centrifuged at 12000 g for 1 min. Discard the supernatant; after the sample is dry, add 11 μl RD to dissolve the precipitate, which is the sample RNA.
[0123] 2. PRSSV RT-LAMP reaction
[0124] ① Prepare RT-LAMP reaction solution: add 12.5 μl of RM, 1.0 μl of EM, and 1.0 μl of PM into the reaction tube;
[0125] ② Take 5.5 μl sample RNA and add it to the tube of the reaction solution prepared in item ①;
[0126] ③ After mixing, place the reacti...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com