Unlock instant, AI-driven research and patent intelligence for your innovation.

CpG methylated oligodeoxynucleotide for inhibiting replication of hepatitis b virus (HBV)

A hepatitis B virus and deoxynucleotide technology, applied in the field of oligodeoxynucleotides, can solve the problem of no HBVcccDNA CpG island methylation, etc., and achieve the effects of easy production and storage, inhibition of replication, and high stability

Inactive Publication Date: 2009-12-30
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, CpG island 2 can be the target of antiviral therapy. By specifically methylating this CpG island, the purpose of inhibiting virus replication can be achieved. However, there is no method that can specifically induce HBV cccDNA CpG island methylation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CpG methylated oligodeoxynucleotide for inhibiting replication of hepatitis b virus (HBV)
  • CpG methylated oligodeoxynucleotide for inhibiting replication of hepatitis b virus (HBV)
  • CpG methylated oligodeoxynucleotide for inhibiting replication of hepatitis b virus (HBV)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The following experiment shows that the selected CpG methylated oligonucleotide can specifically induce the CpG methylation of the complementary sequence of HBV cccDNA and can inhibit HBV DNA replication.

[0051] (1) According to HBV GenBank: CpG island 2 positive strand sequence of U95551.1 strain, select two positive strand sequences containing CpG, artificially synthesize CpG methylated oligodeoxynucleotides MX1, MX2, and respectively with The sequences of unmethylated oligodeoxynucleotides X1 and X2 with the same sequence as MX1 and MX2 are:

[0052] MX1 (methylated): 5'catcagm5cgm5cgtgm5cgtggaa 3' (1227-1245nt)

[0053] X1 (unmethylated): 5'catcagcgcgtgcgtggaa 3' (1227-1245nt)

[0054] MX2 (methylation): 5'gtcctctccm5cgcaaatatacatm5cgt 3' (1347-1371nt)

[0055] X2 (unmethylated): 5'gtcctctcccgcaaatatacatcgt 3' (1347-1371nt)

[0056] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0057] MX1 and X1 are methylated and unmethylated ol...

Embodiment 2

[0066] According to the positive strand sequence of CpG island 2 of the HBV A genotype strain, two positive strand sequences containing CpG were selected, and the corresponding CpG methylated oligodeoxynucleotides MX1 and MX2 were artificially synthesized, and respectively combined with MX1 and MX2 The sequences of unmethylated oligodeoxynucleotides X1 and X2 with the same sequence are:

[0067] MX1: 5'catcagm5cgcatgm5cgtggaa3' (1225-1243nt)

[0068] X1: 5'catcagcgcatgcgtggaa3' (1225-1243nt)

[0069]MX2: 5'gtcctctm5cgm5cggaaatatacatm5cgt3' (1345-1369nt)

[0070] X2: 5'gtcctctcgcggaaatatacatcgt3' (1345-1369nt)

[0071] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0072] The implementation is similar to Example 1.

Embodiment 3

[0074] According to the positive strand sequence of CpG island 2 of the HBV genotype strain, two positive strand sequences containing CpG were selected, and the corresponding CpG methylated oligodeoxynucleotides MX1 and MX2 were artificially synthesized, and respectively combined with MX1 and MX2 The sequences of unmethylated oligodeoxynucleotides X1 and X2 with the same sequence are:

[0075] MX1: 5'catcagm5cgcatgm5cgtggaa 3' (1225-1243nt)

[0076] X1: 5'catcagcgcatgcgtggaa 3' (1225-1243nt)

[0077] MX2: 5'gtgctctccm5cgcaagtatacatcat 3' (1345-1369nt)

[0078] X2: 5'gtgctctcccgcaagtatacatcat 3' (1345-1369nt)

[0079] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0080] The implementation is similar to Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to CpG methylated oligodeoxynucleotide for inhibiting the replication of hepatitis b virus (HBV) in a cell nuclear. A viral relaxed circular DNA (rcDNA) of the HBV after transfecting a host cell enters the cell nuclear to form a covalently closed circular DNA (cccDNA) under the action of a host enzyme, and the cccDNA is combined with biological molecules, such as histone, and the like in a liver cell nuclear to form a viral micro chromosome which is used as a template for the transcription and the replication of a HBV gene. In the invention, a CpG island 2 in a HBV cccDNA sequence is used as a target spot to design and combine into the CpG methylated oligodeoxynucleotide which has 15-30 bases and can inhibite the replication of the HBV. The invention can improve the methylation degree of the complementary HBVcccDNA sequence, can inhibite the replication of HBV DNA, has the advantage of high stability, is easy to product and store and can be used for treatments of resisting HBV infection.

Description

technical field [0001] The invention relates to two CpG methylated oligodeoxynucleotides that can increase the methylation degree of HBV cccDNA and inhibit the replication of HBV cccDNA, specifically, it is a kind of oligodeoxynucleotide that can be used to inhibit the replication of hepatitis B virus in cells CpG methylated oligodeoxynucleotides. technical background [0002] my country is a high-incidence area of ​​hepatitis B, and there are more than 30 million hepatitis B patients. It is a major problem to be solved urgently to find new ways to effectively resist HBV infection. [0003] After hepatitis B virus (HBV) infects host cells, viral relaxed circular DNA (rcDNA) enters the nucleus, and under the action of host enzymes, forms covalently closed circular DNA (cccDNA). cccDNA combines with biomolecules such as histones in the nucleus of liver cells to form a viral minichromosome, which is a template for gene transcription and replication of hepatitis B virus. There...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11A61P31/20C12R1/93C12N15/117
Inventor 郭晏海颜真
Owner FOURTH MILITARY MEDICAL UNIVERSITY