Real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as primer and probe for detection

A technology of real-time fluorescence and detection methods, which is applied in the directions of fluorescence/phosphorescence, measurement/inspection of microorganisms, biochemical equipment and methods, etc., to shorten the detection time and increase the accuracy of identification

Inactive Publication Date: 2010-08-18
SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Yu Daojian et al. (2004) reported the quarantine identification of Bactrocera philippines B.correcta by PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as primer and probe for detection
  • Real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as primer and probe for detection
  • Real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as primer and probe for detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Design Primers and Probes

[0032] According to the sequences of part of the cob-nadh1 gene in the mtDNA (mitochondrial DNA) of Bactrocera dorsalis, B. papaya, B. carambola and B. philippines (GenBank numbers: DQ917577, DQ917578, EF014414, DQ995281) Design the following specific primers G-FP / RP and probe G-MGB (primers and probes are synthesized by Shanghai Jikang Company):

[0033] Upstream primer G-FP: 5'-CGGGCTGTGGCACAAACTAT-3';

[0034] Downstream primer G-RP: 5'-AACTCCGATTCACCTTCTGCAA-3';

[0035] Ceratitis philippines probe G-MGB: FCATTAGTTTTATTATCCTTTGTATTTP

[0036] The detection principle of the above primers and probes is as follows: figure 1 As shown, four kinds of fruit flies (Bactrocera philippines DQ995281, Bactrocera dorsalis DQ917577, Bactrocera carambola EF014414, Bactrocera papaya DQ917578) sequence alignment at the probe positions are shown in figure 2 .

[0037] 2. Extraction of Ceratitis philippines DNA

[0038] Take a sample of Bactrocera...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as a primer and a probe for detection. The invention establishes the real-time fluorescence PCR detecting method of Bactrocera philippinensis according to sequence design specific primers G-FP/RP (a sequence shown in an upstream primer SEQ ID NO.1 and a sequence shown as a downstream primer SEQ ID NO.2) and a probe G-MGB (a sequence shown as an SEQ ID NO.3) of part of cob-nadh1 genes in mtDNA of some similar species of Bactrocera dorsalis hendel, Bactrocera papayae, Bactrocera carambolae and Bactrocera philippinensis (GenBank numbers are respectively DG917577, DQ917578, EF014414 and DQ995281) so as to achieve the aim of rapidly and accurately detecting and authenticating the Bactrocera philippinensis.

Description

technical field [0001] The present invention relates to the technical fields of forestry and plant quarantine, in particular to a detection method for Bactrocera philippines; in particular to a real-time fluorescent PCR detection method for Bactrocera philippines; in addition, the present invention also relates to primers and probes for detecting Bactrocera philippines . Background technique [0002] The Philippine fruit fly Bactrocera philippinensis belongs to Diptera (Diptera), Tephritidae (Tephritidae), and the genus Bactrocera. Mainly distributed in Southeast Asian countries such as the Philippines, the hosts mainly include fruit cash crops such as wood pineapple, papaya, rose apple, mango, and peach olive. It caused serious losses to fruit production in its distribution area, and was included in the "List of Plant Quarantine Pests Entering China". Due to the increasing trade volume of fresh fruits between my country and Southeast Asian countries, the risk of Bactrocer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68G01N21/64C12N15/11
Inventor 叶军房蕊易建平
Owner SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap