Recombinant Pseudomonas putida CH01 capable of adsorbing heavy metal cadmium and application thereof

A technology of Pseudomonas putida and heavy metals, which is applied in the direction of recombinant DNA technology, bacteria, and the recovery of contaminated soil, etc., can solve the problem of weak tolerance of heavy metals, reduce the effective adsorption cycle of engineering bacteria, and improve the adsorption efficiency and capacity. Obvious enhancement and other issues to achieve the effect of reducing biological toxicity and promoting stable and high yield

Inactive Publication Date: 2010-11-24
HUAZHONG AGRI UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the tolerance of E. coli to heavy metals is weak, and the effective adsorption period of engineering bacteria is reduced after the engineering bacteria adsorb heavy metals, and the single MT molecule does not significantly enhance the adsorption efficiency and capacity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Pseudomonas putida CH01 capable of adsorbing heavy metal cadmium and application thereof
  • Recombinant Pseudomonas putida CH01 capable of adsorbing heavy metal cadmium and application thereof
  • Recombinant Pseudomonas putida CH01 capable of adsorbing heavy metal cadmium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Construction of functional plasmid pCIM for repairing cadmium pollution

[0034] The source of the nucleotide sequence utilized in the present invention is as follows: the cadmium responsive promoter is derived from Pseudomonas putida KT2440 (Pseudomonasputida) KT2440 (see SEQ ID NO: 3); the monkey metallothionein α domain sequence (see SEQ ID NO: 3) ID NO: 2), the sequence was provided by the laboratory of Professor Huang Zhongxian of Fudan University; inaX-N was derived from Xanthomonas campestris ATCC33913 (see SEQ ID NO: 1).

[0035] 1. Acquisition of Inax-N of Xanthomonas campestris

[0036]The applicant used the total DNA of Xanthomonas campestris ATCC33913 as a template, designed the upstream primer: 5'CCATGGATCGCGAAAAAGTCTTGG3', and the downstream primer 5'GAATTCTGCGTACCCGCGAAAT3', and carried out PCR amplification. PCR system includes 10×Buffer 2.5μl, Mg 2+ 1 μl, 2.5 μl of dNTP, 2 μl of template DNA, 1 μl of each primer, 0.5 μl of KOD-Plus, ddH 2 O...

Embodiment 2

[0063] Example 2 Experiment of the cadmium adsorption capacity of the genetically engineered bacteria CH01 of the present invention

[0064] 1. Adsorption of growing cadmium

[0065] The genetically engineered bacteria CHO1 constructed in the present invention and the starting strain Pseudomonas putida X4 were cultured overnight in the MJS medium containing the corresponding antibiotics, and then inoculated into 50 ml of fresh medium at a ratio of 1:100 and cultured to OD. 600 0.6, then add CdC1 with a final concentration of 100 μmol / L 2 , 2mL were sampled at 11h, 21h, and 31h, respectively, to measure the adsorption amount of cadmium. The specific measurement method is to centrifuge the bacterial sample at 13000 r / min for 5 min, wash the precipitate three times with 5 mmol / L HEPES buffer (pH 7.1) mixed with 0.8% NaCl solution, dry at 65 °C for 24 h, and then add 100 μL of concentrated nitric acid for 48 h. product with ddH 2 O dilution, and then the content of cadmium in t...

Embodiment 3

[0069] The genetic engineering bacteria CH01 of the present invention and the plant symbiotic hydroponic experiment

[0070] The plant nutrient solution for hydroponic culture prepared by the present invention is shown in Table 1.

[0071] Table 1 The formula of plant nutrient solution for hydroponics experiment

[0072]

[0073] The concrete steps of this embodiment are as follows:

[0074] (1) Soak corn and cowpea seeds with 95% ethanol for 5 minutes, then wash with 100% NaClO for 5 minutes, and then rinse with sterile water for 5-10 times. Put the corn and cowpea seeds in a petri dish with sterile water, and place them in a constant temperature light incubator at 28°C for germination. After the water in the petri dish of corn and cowpea seeds becomes turbid, change the water, and take about 3 days to root. The rooted seeds were placed on quartz sand to continue cultivation, and Hoagland's nutrient solution was poured once a day, and cultivated under constant temperatur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the soil environment management field in the environmental engineering and relates to the construction and application of a new genetically engineered microorganism capable of restoring the soil polluted by heavy metal cadmium. The preparation method of the genetically engineered microorganism comprises the following steps: monkey metallothionein alpha structure domain tetramer is fused in the ice-nucleating protein N-end of Xanthomona campestris ATCC33913 to be used as a main functional unit for constructing a broad host range expression plasmid; then cadmium-specific promoter is used for expression in Pseudomonas putida X4 which can resist various heavy metals efficiently, thus realizing the surface display of monkey metallothionein alpha structure domain tetramer in the bacterium and obtaining genetically engineered microorganism CH01 which can adsorb heavy metal cadmium efficiently and specifically. The engineered microorganism can remarkably adsorb heavy metal cadmium in the presence of various heavy metals; and the result of the symbiotic water culture with wheat, cowpea and corn shows that the engineered microorganism CH01 can colonize in the rhizosphere of plant and fast adsorb cadmium ions. The invention also discloses a construction method of the genetically engineered microorganism CH01 of which preservation number is CGMCC No.M209320.

Description

technical field [0001] The invention belongs to the field of environmental engineering soil environment treatment. It specifically relates to the construction and application of a new genetically engineered bacterium for microbial remediation of heavy metal cadmium-contaminated soil. The present invention relates to the fields of microbial genetic engineering and environmental engineering. Background technique [0002] Cadmium is a typical dispersed heavy metal element, which mainly exists in copper, lead, zinc and other non-ferrous metal deposits in the form of sulfide. With human activities, cadmium enters the environment in various ways, causing serious cadmium pollution. Cadmium has the characteristics of stable accumulation and difficult elimination in the environment, and the biggest characteristic of cadmium migration and transformation is that it cannot or is not easy to be decomposed and transformed by organisms and then excreted, it is not easy to move with water...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/78B09C1/10C12R1/40
Inventor黄巧云陈雯莉李友国雷磊王珂征何小川
OwnerHUAZHONG AGRI UNIV