Primer group and detection system for detecting poliovirus by loop-mediated isothermal amplification technique
A technique for poliomyelitis and ring-mediated constant temperature, which is applied in the direction of recombinant DNA technology, disease resistance to vector-borne diseases, and microbial measurement/inspection, can solve the problems of unintuitive result judgment, limited application, and high requirements for testing equipment, and achieve It is easy to popularize and apply in a large range, easy to identify, and has the effect of broad market prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: Specific Genome Sequence Search and LAMP Primer Design
[0045] The poliovirus genome sequence was retrieved from GenBank, and the homology analysis was performed by BLAST software to find the specific conserved target sequence of poliovirus. The DNA sequence of the conserved target sequence is:
[0046] AGGACCACTCCAGTATAAAGACTTGAAGATTGACATCAAGACGAGTCCCCCTCCTGAATGTATCAATGACTTGCTCCAAGCAGTTGACTCCCAGGAGGTGAGAGATTACTGTGAGAAGAAGGGTTGGATAGTCAAACATCACCAGCCAGGTTCAAACAGAAAGGAACATCAACAGGGCAATGACAATTCTACAAGCGGTGACAACCTTCGCCGCAGTGGCTGGAGTTGT
[0047] LAMP primer design
[0048] The specific LAMP primers designed (primers for detection of poliovirus by loop-mediated constant temperature amplification technique) are:
[0049] sequence
Embodiment 2
[0050] Embodiment 2: the establishment of detection system
[0051] By setting different final concentrations of Mg 2+ (4mmol / L, 5mmol / L, 6mmol / L, 7mmol / L, 8mmol / L, 9mmol / L, 10mmol / L), dNTP (0.8mmol / L, 1.0mmol / L, 1.2mmol / L, 1.4mmol / L L, 1.6mmol / L, 1.8mmol / L, 2.0mmol / L), Betaine (0.2mol / L, 0.4mol / L, 0.6mol / L, 0.8mol / L, 1mol / L, 1.2mol / L) and The temperature (60°C, 61°C, 62°C, 63°C, 64°C, 65°C) was optimized to obtain the best reaction parameters, so as to establish the poliovirus LAMP detection system. One of the optimized detection systems (20μL) is as follows:
[0052] 2.5 μL of 10× ThermoPol buffer;
[0053]25mmol / L Mg 2+ 5 μL;
[0054] 5mol / L Betaine 2μL;
[0055] 50mmol / L dNTP 0.8μL;
[0056] 0.5 μL of the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing of 10 μmol / L;
[0057] 0.5 μL of the nucleotide sequence shown in SEQ ID NO.2 in the sequence listing of 10 μmol / L;
[0058] 0.4 μL of the nucleotide sequence shown in SEQ ID NO.3 in the sequence l...
Embodiment 3
[0064] Example 3: A detection system for poliovirus detection using loop-mediated constant temperature amplification technology, the system consists of the following raw materials:
[0065] 2.5 μL of 10× ThermoPol buffer;
[0066] 25mmol / L Mg 2+ 6 μL;
[0067] 5mol / L Betaine 1μL;
[0068] 50mmol / L dNTP 0.6μL;
[0069] 0.5 μL of the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing of 10 μmol / L;
[0070] 0.5 μL of the nucleotide sequence shown in SEQ ID NO.2 in the sequence listing of 10 μmol / L;
[0071] 0.4 μL of the nucleotide sequence shown in SEQ ID NO.3 in the sequence listing of 100 μmol / L;
[0072] 0.4 μL of the nucleotide sequence shown in SEQ ID NO.4 in the sequence listing of 100 μmol / L;
[0073] 1 μL of 8U / μL Bst enzyme;
[0074] Add ultrapure water to a total volume of 20 μL.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 