Primer group and detection system for detecting poliovirus by loop-mediated isothermal amplification technique

A technique for poliomyelitis and ring-mediated constant temperature, which is applied in the direction of recombinant DNA technology, disease resistance to vector-borne diseases, and microbial measurement/inspection, can solve the problems of unintuitive result judgment, limited application, and high requirements for testing equipment, and achieve It is easy to popularize and apply in a large range, easy to identify, and has the effect of broad market prospects

Inactive Publication Date: 2010-11-24
LOGISTICS UNIV OF CAPF
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the PCR method has problems such as high requirements for detection equ

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and detection system for detecting poliovirus by loop-mediated isothermal amplification technique
  • Primer group and detection system for detecting poliovirus by loop-mediated isothermal amplification technique
  • Primer group and detection system for detecting poliovirus by loop-mediated isothermal amplification technique

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0044] Example 1: Search for specific genome sequence and design of LAMP primers

[0045] The poliovirus genome sequence was retrieved from GenBank, and the homology analysis was performed through BLAST software to find the specific conservative target sequence of poliovirus. The DNA sequence of the conservative target sequence is:

[0046] AGGACCACTCCAGTATAAAGACTTGAAGATTGACATCAAGACGAGTCCCCCTCCTGAATGTATCAATGACTTGCTCCAAGCAGTTGACTCCCAGGAGGTGAGAGATTACTGTGAGAAGAAGGGTTGGATAGTCAACATCACCAGCCAGGTTCAAACAGAAAGGAACATCAACAGGGCAATGACAATTCTACAAGCTGACTGTCTGACTGTCAATGGTTCAAACAGAAAGGAACATCAACAGGGCAATGACAATTCTACAAGCTGTCTG

[0047] LAMP primer design

[0048] The specific designed LAMP primers (primers for detecting poliovirus using loop-mediated isothermal amplification technology) are:

[0049] sequence

Example Embodiment

[0050] Example 2: Establishment of detection system

[0051] By setting different final concentrations of Mg 2+ (4mmol / L, 5mmol / L, 6mmol / L, 7mmol / L, 8mmol / L, 9mmol / L, 10mmol / L), dNTP (0.8mmol / L, 1.0mmol / L, 1.2mmol / L, 1.4mmol / L, 1.6mmol / L, 1.8mmol / L, 2.0mmol / L), Betaine (0.2mol / L, 0.4mol / L, 0.6mol / L, 0.8mol / L, 1mol / L, 1.2mol / L) and Temperature (60°C, 61°C, 62°C, 63°C, 64°C, 65°C) was optimized to obtain the best response parameters to establish a poliovirus LAMP detection system. One of the optimized detection systems (20μL) is as follows:

[0052] 2.5μL of 10× ThermoPol buffer;

[0053] 25mmol / L of Mg 2+ 5μL;

[0054] 5mol / L Betaine 2μL;

[0055] 50mmol / L dNTP 0.8μL;

[0056] 0.5μL of the nucleotide sequence shown in SEQ ID NO.1 in the 10μmol / L sequence table;

[0057] 0.5μL of the nucleotide sequence shown in SEQ ID NO.2 in the 10μmol / L sequence table;

[0058] 0.4μL of the nucleotide sequence shown in SEQ ID NO.3 in the 100μmol / L sequence table;

[0059] 0.4 μL of the nucleotide sequ...

Example Embodiment

[0064] Example 3: A detection system for the detection of poliovirus using loop-mediated isothermal amplification technology, which consists of the following raw materials:

[0065] 2.5μL of 10× ThermoPol buffer;

[0066] 25mmol / L of Mg 2+ 6μL;

[0067] 5mol / L Betaine 1μL;

[0068] 50mmol / L dNTP 0.6μL;

[0069] 0.5μL of the nucleotide sequence shown in SEQ ID NO.1 in the 10μmol / L sequence table;

[0070] 0.5μL of the nucleotide sequence shown in SEQ ID NO.2 in the 10μmol / L sequence table;

[0071] 0.4μL of the nucleotide sequence shown in SEQ ID NO.3 in the 100μmol / L sequence table;

[0072] 0.4 μL of the nucleotide sequence shown in SEQ ID NO. 4 in the 100 μmol / L sequence table;

[0073] 8U / μL of Bst enzyme 1μL;

[0074] Add ultrapure water to a total volume of 20μL.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer group and a detection system for detecting poliovirus by a loop-mediated isothermal amplification technique. The primer group for detecting the poliovirus by the loop-mediated isothermal amplification technique consists of nucleotide sequences shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, and SEQ ID No.4 in a sequence table. The detection system can quickly, conveniently, efficiently and highly specifically and sensitively detect the poliovirus under the isothermal condition without any complex instrument, and provides a novel technical platform for the detection of the poliovirus.

Description

technical field [0001] The invention relates to a primer set, detection system, detection method and application for detecting poliovirus by loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP). Background technique [0002] Poliomyelitis (poliomyelitis) virus is a type of enterovirus, which often invades the central nervous system and causes flaccid paralysis of the limbs. It is more common in children, so it is also called polio. The disease is prevalent all over the world and seriously threatens human health. In 1988, the World Health Assembly adopted the global goal of eradicating polio by 2000. Infection reports of wild poliovirus strains decreased significantly, but vaccine-derived polioviruses simultaneously became a deadly form of circulation. Therefore, it is of great significance to strengthen the detection of poliovirus and establish a rapid and accurate detection method. [0003] The traditional detection method of enterovirus i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCY02A50/30
Inventor 赵化冰高宏生赵宏李国良孟斌张国辉黄爱华王俊虹王毅铮尹光雅赵国平
Owner LOGISTICS UNIV OF CAPF
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap