Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dye fluorescent quantitative primer for detecting positive reovirus and kit

A technology of fluorescence quantification and kits, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. It can solve the problems of unsatisfactory accuracy, large gene sequence differences, and inapplicability. The effect of wide detection range, few operation steps and convenient identification

Pending Publication Date: 2020-07-03
SOUTHWEST UNIVERSITY FOR NATIONALITIES
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the research data, the gene sequence of the virus mutates rapidly, and the gene sequence differences between different strains are large. At present, foreign researchers have established a detection system for the virus, but the method is not applicable in China. Common PCR and fluorescence detection kits often have false positive problems, so the accuracy of the detection results needs to be studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dye fluorescent quantitative primer for detecting positive reovirus and kit
  • Dye fluorescent quantitative primer for detecting positive reovirus and kit
  • Dye fluorescent quantitative primer for detecting positive reovirus and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Primer design

[0034] According to the published strain sequences of MRV genes registered in NCBI at home and abroad (AF368033.1, DQ664184.1, DQ997719.1, EF494435.1, GQ468266.1, GU196306.1, HM159613.1, JN799426.1), the application Beacon Designer 7.7 software designed specific primers for the L1 gene of MRV, and all primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0035] Upstream primer MRV F: TATATTGATGCTCTAAATCGTGTG, SEQ ID NO: 1;

[0036] Downstream primer MRV R: TTCTGGCTTGGCTATCTCC, SEQ ID NO:2.

Embodiment 2

[0038] Establishment of a fluorescent quantitative RT-PCR method for detection of mammalian orthoreovirus:

[0039] The method includes the following steps:

[0040] (1) RNA extraction of samples to be tested:

[0041] Fully resuspend and mix the positive stool sample with PBS (1:5), freeze and thaw three times in the refrigerator at -80°C, centrifuge at 3,000rpm for 10min, discard the precipitate, then centrifuge at 12,000rpm for 30min, take the supernatant, and follow the Trizol Reagent Total RNA was extracted according to the instructions, and cDNA was synthesized according to the instructions of the reverse transcription kit, and stored at -20°C for future use. Bacterial DNA was extracted by the phenol-chloroform method and stored at -20°C for future use.

[0042] (2) Add the extracted RNA to the reverse transcription kit for reverse transcription to obtain the cDNA template:

[0043]The reverse transcription step is as follows: Mix 4 μL of RNA template, 4 μL of No. 1 5...

Embodiment 3

[0047] Optimization of annealing temperature, primer concentration and probe concentration, determination of sensitivity, stability and specificity

[0048] (1) Optimization of the annealing temperature: the annealing temperature in the MRV F / R primer reaction conditions is set at 48°C-56°C, observe the amplification peak diagram of the fluorescent quantitative PCR instrument, and select the one with the smallest CT value as the optimal annealing temperature, The optimum annealing temperature of the present invention is 56°C.

[0049] (2) Optimization of primer concentration: 20 μL reaction system for PCR, 0.2 μL to 1 μL each for upstream and downstream primers. The primer concentration with the smallest CT value was selected as the optimal primer concentration, and the optimal primer concentration was 0.5 μL.

[0050] (3) Sensitivity evaluation:

[0051] Cloning transformation and recombinant positive plasmid: RT-PCR amplifies the target gene, and conducts electrophoresis o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a dye fluorescent quantitative RT PCR primer, a kit and application thereof. The primer comprises an upstream primer MRV F and a downstream primer MRV R, wherein the nucleotide sequence of the upstream primer MRV F is shown as SEQ ID NO: 1, and the nucleotide sequence of the downstream primer MRV R is shown as SEQ ID NO: 2. The specific primer and the kit can be used forrapidly and accurately identifying the positive reovirus of a mammal, and have the characteristics of simplicity, rapidness, high sensitivity and strong specificity.

Description

technical field [0001] The invention belongs to the technical field of virus detection, in particular to a dye fluorescent quantitative RT-PCR primer and a kit for detecting mammalian orthoreovirus. Background technique [0002] Reovirus was isolated from the respiratory tract and gastrointestinal tract of healthy children by Sabin and Ramos-Alvarez in 1954. It was initially believed that the virus was not related to any disease, so it was named Respiratory , enteric, and orphan virus, take the prefixes of three English words and abbreviate them as Reovirus. In recent years, mammalian orthoreovirus has attracted the attention of scholars from various countries as the pathogen of respiratory tract and digestive tract diseases. Since the 1950s, MRV (mammalian orthoreovirus) has been isolated from mammals such as humans, dogs, cows, minks, civet cats, and bats. MRV has been proven to not only cause human hemorrhagic enteritis, acute respiratory infection, encephalitis and oth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2563/107
Inventor 汤承岳华王远微陈虹吟
Owner SOUTHWEST UNIVERSITY FOR NATIONALITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com