Supercharge Your Innovation With Domain-Expert AI Agents!

Composite insect virus synergist and preparation method thereof

A technology of insect virus and synergist, applied in the direction of botanical equipment and methods, insecticides, biocides, etc., to achieve the effect of shortening the lethal time

Inactive Publication Date: 2014-07-23
NORTHWEST A & F UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cantharidin is currently mainly used and researched in medicine. There are already cantharidin and its derivatives as pharmaceutical products, which are mainly used as anti-cancer effective substances, and have therapeutic effects on various cancers. In addition to anti-cancer, there are also therapeutic effects on viral Role of chronic hepatitis B, leukemia, rabies, skin infections

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0034] The preparation method of composite insect virus synergist of the present invention, specifically implement according to the following steps:

[0035] step 1:

[0036] a. Preparation of toxin protein aqueous solution

[0037] (1) Source of toxin protein gene and construction of genetically engineered strains expressing toxin protein:

[0038] The CryIAB gene was cloned from the isolated Bacillus thuringiensis, and the expression vector PET-28a-CryIAB was constructed after gene cloning and sequencing identification. The expression vector was transformed into E.coliBL21 by electric shock, and the engineering strain E.coliBL21-28a-CryIAB containing the CryIAB toxin protein gene was obtained.

[0039] The sequence of the CryIAB gene is:

[0040] ATGGATAACAATCCGAACATCAATGAATGCATTCCTTAATTGTTTAAG

[0041] TAACCCTGAAGTAGAAGTATTAGGTGGAGAAAGAATAGAAACTGGTTA

[0042] CACCCCAATCGATATTTCCTTGTCGCTAACGCAATTTCTTTTGAGTGAAT

[0043] TTGTTCCCGGTGCTGGATTTGTGTTAGGACTAGTTGATATAATATGGGGA...

Embodiment 1

[0124] step 1:

[0125] a. Preparation of toxin protein aqueous solution

[0126] (1) Induced expression of toxin protein:

[0127] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.

[0128] (2) Collection of expressed proteins:

[0129] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic ...

Embodiment 2

[0137] step 1:

[0138] a. Preparation of toxin protein aqueous solution

[0139] (1) Induced expression of toxin protein:

[0140] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.

[0141] (2) Collection of expressed proteins:

[0142] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a composite insect virus synergist, which comprises the following components in percentage by volume: 2 to 8 percent of aqueous solution of toxin protein, 0.3 to 1.5 percent of emulsifiable solution of cantharidin, 1 to 3 percent of Tween-80 emulsifier and the balance of 1*PBS buffer solution, wherein the total volume of the components is 100 percent. The preparation method of the synergist is implemented by the following steps: constructing a toxin protein expressing genetic engineering strain; inducing the expression of the toxin protein; collecting expressed toxin protein; preparing aqueous solution of active toxin protein; mixing the components to obtain the composite insect virus synergist. The composite insect virus synergist and the preparation method thereof have the advantages that: the preparation process is simple; the prepared synergist can improve the insecticidal activity of insect virus insecticides and improve control efficiency.

Description

technical field [0001] The invention belongs to the technical field of pest biological control, and specifically relates to a compound insect virus synergist, and also relates to a preparation method of the synergist. Background technique [0002] The baculovirus presents an attractive prospect in the sustainable control of pests, and a variety of baculoviruses have been used in the biological control of pests at home and abroad. Among them, NPV has been successfully applied to the control of pests. NPV is the first commercialized insecticide in my country, which has the advantages of safe use and no resistance of pests. However, the lethal effect of viruses on insects is relatively slow, usually within 1 to 2 weeks. In this case, although the pests are eventually killed by the virus, the pests often cause irreparable economic losses to agricultural and forestry crops before they are killed. This is exactly one of the main bottleneck problems in the production and applicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N63/02A01N43/90A01P7/04
Inventor 王敦张雅林李坚项林平刘强徐红星甘恩宇
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com