Composite insect virus synergist and preparation method thereof
A technology of insect virus and synergist, applied in the direction of botanical equipment and methods, insecticides, biocides, etc., to achieve the effect of shortening the lethal time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
preparation example Construction
[0034] The preparation method of composite insect virus synergist of the present invention, specifically implement according to the following steps:
[0035] step 1:
[0036] a. Preparation of toxin protein aqueous solution
[0037] (1) Source of toxin protein gene and construction of genetically engineered strains expressing toxin protein:
[0038] The CryIAB gene was cloned from the isolated Bacillus thuringiensis, and the expression vector PET-28a-CryIAB was constructed after gene cloning and sequencing identification. The expression vector was transformed into E.coliBL21 by electric shock, and the engineering strain E.coliBL21-28a-CryIAB containing the CryIAB toxin protein gene was obtained.
[0039] The sequence of the CryIAB gene is:
[0040] ATGGATAACAATCCGAACATCAATGAATGCATTCCTTAATTGTTTAAG
[0041] TAACCCTGAAGTAGAAGTATTAGGTGGAGAAAGAATAGAAACTGGTTA
[0042] CACCCCAATCGATATTTCCTTGTCGCTAACGCAATTTCTTTTGAGTGAAT
[0043] TTGTTCCCGGTGCTGGATTTGTGTTAGGACTAGTTGATATAATATGGGGA...
Embodiment 1
[0124] step 1:
[0125] a. Preparation of toxin protein aqueous solution
[0126] (1) Induced expression of toxin protein:
[0127] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.
[0128] (2) Collection of expressed proteins:
[0129] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic ...
Embodiment 2
[0137] step 1:
[0138] a. Preparation of toxin protein aqueous solution
[0139] (1) Induced expression of toxin protein:
[0140] Pick a single colony of the engineering strain E.coli BL21-28a-CryIAB, inoculate it in 10ml liquid LB medium containing 100ug / ml ampicillin, and cultivate overnight at 37°C with shaking at 200r / min. Inoculate at 1% (V / V) in 1L liquid LB medium containing 100ug / ml ampicillin, culture at 37°C and 260r / min until the OD600 of the bacterial solution is 0.3-0.5, then add an appropriate concentration of IPTG (final concentration 10uM) , to induce expression, 25-35°C, 200-320rpm, induction 4-8hr.
[0141] (2) Collection of expressed proteins:
[0142] 1L of expressing bacteria was collected by centrifugation at 6000rpm for 5min, resuspended in 100ml of PBS buffer, and washed to remove medium components; repeat the above process 1-2 times. Collect the cells by centrifugation, suspend the cells in 10ml of PBS buffer, and disrupt the cells by ultrasonic ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap