Methods and compositions related to immunizing against staphylococcal lung diseases and conditions
A staphylococcus, lung disease technology, applied in the fields of immunology, microbiology, epidemiology and medicine, to solve problems such as the difficulty of vaccine protection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0218] Vaccine-mediated protection against Staphylococcus aureus
[0219] A. method
[0220] Bacterial strains and cultures. Staphylococcus aureus Newman, LAC and MW2 were propagated in Tryptone Soy Broth (TSB) or Tryptone Soy Agar (TSA). To obtain PVL-transformed phage, lytic replication of φSa2mw in S. aureus MW2 cultures was induced with 1 μg / ml mitomycin C. The lysate was filtered with a 0.22 μm membrane and the filtrate was used for plaque formation on S. aureus RN4220 (Bae et al. 2006). The phage suspension was mixed with 1 ml of the mid-log phase culture of bacterial strain RN4220 (grown in 5 mM CaCl 2 heart infusion broth (HIBCa5)) and then amplified by overnight incubation at 37°C. DNA was purified from amplified phage particles by phenol / chloroform extraction. φSa2mw was detected by PCR amplification of lukS-PV DNA using primers cctcctgttgatggaccact (SEQ ID NO: 3) and ggcgctgaggtagtcaaaag (SEQ ID NO: 4). The φSa2mw phage solution was mixed with a mid-log cult...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com