Non-human mammal model of epilepsy

A technology for non-human mammals and epilepsy, applied in the field of mutant genes, can solve the problems of low probability and time-consuming homologous recombination

Inactive Publication Date: 2011-02-09
FUKUOKA UNIV +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, due to the low probability of homologous recombination in the preparation of the genetically recombined model animals by previous techniques, it is necessary to screen a large number of recombinants
In addition, in the screening of recombinants, it is necessary to sequence a part of their genes, which takes considerable time and cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-human mammal model of epilepsy
  • Non-human mammal model of epilepsy
  • Non-human mammal model of epilepsy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0167] First, using rat brain QUICK-Clone cDNA (CLONTECH; MountainView, CA) as a template, two primers designed based on the existing cDNA sequence of rat Chrna4, namely, the forward primer (BN-rat CHRNA4cDNA-F ):

[0168] AGATCTCGCGAAGCTTCACCATGGCCAATTCGGGCACCGG (40-mer) (SEQ ID NO: 3) and

[0169] Reverse primer (rat CHRNA4cDNA-BX-R):

[0170] AGATCTAGATCAGCAAGCAGCCAGCCAGGGAGGCAGGA (38-mer) (SEQ ID NO: 4)

[0171] PCR was performed. The resulting PCR product was purified and subcloned into the pCRII-TOPO vector (Invitorogen; Carlsbad, CA). The obtained clone was sequenced to determine the base sequence of the cDNA of Chrna4. Among them, the base sequence information of rat is registered under the accession number L31620 (NCBI).

[0172] The resulting clones were mutated using the QuikChange Site-Specific Mutagenesis Kit (STRATAGENE; La Jolla, CA). First, use r845T846C-sen: CACACTGTGCATCTTCGTGCTGCTTTCTC (29-mer) (SEQ ID NO: 7) and r845T846C-ant: GAGAAAGCAGCACGAAGATGCACA...

Embodiment 2

[0179]As in Example 1, use r856C857T-sen: CGGTGCTGCTTTCTTTCACCGTCTTCCTG (29-mer) (SEQ ID NO: 10) and r856C857T-ant: CAGGAAGACGGTGAGAAGAAGCAGCACCG (29-mer) (SEQ ID NO: 11) to mutate the T at position 856 of the cDNA base sequence For C, mutate C at position 857 to T. The base sequence of the obtained mutant cDNA is shown in SEQ ID NO:12. Thus, the amino acid residue Ser at position p.286, which is homologous to the α4 subunit of the human neuronal acetylcholine receptor, was mutated to the amino acid residue Leu.

[0180] To c.104 to c.221 of the thus prepared mutated cDNA, a probe containing 118 bp of nucleotides shown in SEQ ID NO: 23 was prepared and introduced as in Example 1.

[0181] Using the mutated cDNA into which the probe was introduced as described above, a recombinant was prepared as in Example 1.

Embodiment 3

[0183] As in Example 1, use sense primer rCHRNA-878insGCT-sen: GTCTTCCTGCTGCTGCTCATCACCGAGATC (30-mer) (SEQ ID NO: 13) and antisense primer rCHRNA-878insGCT-ant: GATCTCGGTGATGAGCAGCAGCAGGAAGAC (30-mer) (SEQ IDNO: 14) in cDNA A GCT is inserted between the 878th and 879th positions of the base sequence. The base sequence of the obtained mutant cDNA is shown in SEQ ID NO:15. Thus, an amino acid residue Leu was inserted between the amino acid residue Leu at position p.293 and the amino acid residue Ile at position p.294, which are homologous to the α4 subunit of the human neuronal acetylcholine receptor.

[0184] Using the mutated cDNA thus prepared, a recombinant was prepared as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a genuine model animal of epilepsy, since most of the existing model animals are so-called seizure model animals showing forcibly-induced seizure. Also provided is a method whereby a recombinant can be easily distinguished. A non-human mammal model of epilepsy which is an epilepsy model of a non-human animal such as rat having the same genetic defect as human genetic defect causing epilepsy, which carries a genetic mutation that is the genetic defect having been transferred into the non-human mammal DNA of neuron nicotinic acetylcholine receptor a4 subunit (CHRNA4) gene or ss2 subunit (CHRNB2) gene relating to human autosomal dominant nocturnal frontal lobe epilepsy and which also carries a mutated gene obtained by transferring a specific probe thereinto. A recombinant of this non-human mammal model of epilepsy can be easily distinguished.

Description

technical field [0001] The present invention relates to epilepsy model non-human mammals. More specifically, the invention relates to epilepsy model non-human mammals having genetically abnormal, spontaneous seizures homologous to genes associated with human autosomal dominant nocturnal frontal lobe epilepsy. In addition, the present invention relates to a mutant gene that allows easy identification of genetically recombined individuals, its construction method, and its identification method. Background technique [0002] Epilepsy is a relatively common neurological disease affecting about 2% of Japanese nationals, and its molecular biological cause has been unknown for a long time. The reason for this is that epilepsy is a general term for various diseases. However, recently, a genetic abnormality has been known, centering on familial epilepsy. [0003] Among them, autosomal dominant nocturnal frontal lobe epilepsy is one of familial epilepsy, which is characterized by n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68A01K67/02C12N15/09A01K67/027
CPCC12Q2600/156A01K2267/0356C12N15/8509C12Q1/6883A01K2217/052A01K2227/105C07K14/70571A01K2267/0306A01K67/0275A01K2217/056
Inventor广濑伸一兼子直
OwnerFUKUOKA UNIV