Method for detecting Jassr131 microsatellite deoxyribonucleic acid (DNA) marker of Charybdis japonica

A DNA labeling and detection method technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems that have not yet been seen, and achieve the effect of simple method

A DNA labeling and detection method technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems that have not yet been seen, and achieve the effect of simple method

CN102162009AInactive Publication Date: 2011-08-24YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting Jassr131 microsatellite deoxyribonucleic acid (DNA) marker of Charybdis japonica
  • Method for detecting Jassr131 microsatellite deoxyribonucleic acid (DNA) marker of Charybdis japonica

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0016] The following examples describe in detail the present invention's DNA molecular genetic marker technology of Jassr131 microsatellite core sequence. Firstly, extract the genomic DNA of Japanese catfish and dilute it for later use; then use the Jassr131 microsatellite core sequence in the Japanese catfish genome library, and design specific primers at both ends of the sequence; The genomic DNA was amplified by PCR, and the PCR products were detected by polyacrylamide gel electrophoresis; the bands that appeared in the products were analyzed to determine the genotype of each individual, and obtained the polymorphism of the highly genetic variation in the core sequence region of Jassr131 in Jassr131. Morphological map (as shown in Figure 1).

[0017] The core sequence of Jassr131 in Japanese catfish is as follows:

[0018] GATCTT CCAGGGAATTGAAACACT AATTTGGCATTTTAGAGTAAGCTATCTAATTTTTTTTCAGCAAGTCTCCTGTTATTTTATTGATTGATAGATTAGTGCTTGAGTGAGTGAGTGAGTG G G TGAACGAGTGGGTGAGTCAGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting a Jassr131 microsatellite deoxyribonucleic acid (DNA) marker of Charybdis japonica. The method is characterized by comprising the following steps of: extracting genomic DNA of the Charybdis japonica and diluting for later use; designing a specific primer at both ends of a Jassr131 microsatellite core sequence in an enriched microsatellite library of the Charybdis japonica; performing polymerase chain reaction (PCR) amplification on genomic DNA of different geographical populations of the Charybdis japonica or genomic DNA of individuals in the populations by using the primer, and detecting a PCR product by using metamorphic polyacrylamide gel; and analyzing by utilizing stripes of the product, and determining a genotype of each individual so as to obtain a polymorphic map of high genetic variation of the Charybdis japonica in a Jassr131 core sequence region. Sequences of the specific primer of the Jassr131 microsatellite core sequence are that: the sequence of a plus strand is 5'-CCAGGGAATTGAAACACT-3', and the sequence of a minus strand is 3'-TATGAAGGCTCTGCGAAA-5'; and the annealing temperature is 50 DEG C. The method is simple and convenient; and the genotype of each individual of the Charybdis japonica at the site can be intuitively detected according to the obtained results.

Description

technical field [0001] The invention belongs to the technology of microsatellite DNA molecular genetic markers of japonica, in particular to a method for detecting the microsatellite DNA marker of japonica Jassr131. Background technique [0002] Before the present invention was made, there were relevant research reports in other crabs both at home and abroad. In the study of Dungeness crab (Cancer magister), Pamela C.Jensen et al. designed 99 microsatellite primers, and among them 9 of them were synthesized. Using nylon membrane hybridization method, Masatsugu takhano et al. found five variable microsatellite loci in Scylla serrata. David Gopurenko et al screened 5 microsatellite loci in the study of Scylla serrata (Scylla paramamosain). Using conventional methods, E.S Yap et al. screened 7 microsatellite loci containing dinucleotide repeating units and 1 containing tetranucleotide repeating units in Portunus pelagicus. H.S.AN et al. used PCR screening method to screen 9 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
24 Aug 2011
Publication
CN102162009A
IPC
C12Q1/68
Inventors
刘萍; 李健