Method for detecting gene fusion
A gene fusion and gene technology, applied in the field of detection, can solve the problems of not being able to detect the ALK fusion gene, affecting the detection rate of the ALK gene, and being difficult to detect the fusion at the same time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0111] sample
[0112] The samples in this example come from 103 patients with non-small cell lung cancer who underwent surgery in Guangdong Provincial People's Hospital, and the obtained samples were used for the detection of ALK fusion gene. These samples were collected between 2004 and 2006 and included 62 adenocarcinomas, 29 squamous cell carcinomas, 11 large cell carcinomas, and 1 leiomyosarcoma. Informed consent was issued to each patient and the patient's consent was obtained. This study was approved by the Ethics Committee of Guangdong Provincial People's Hospital. All 103 samples are qualified samples and can be used for detection of ALK fusion gene.
[0113] RNA extraction
[0114] Total RNA was extracted using a commercially available RNeasy kit (purchased from QIAGEN, Valencia, CA). All samples were pathologically evaluated and the proportion of tumors was guaranteed to be no less than 80%.
[0115] Primer
[0116] The following primers were synthesized by ar...
Embodiment 2
[0150] Kit for detecting ALK fusion gene
[0151] Prepare a kit that can be used to detect ALK fusion gene, said kit includes five containers, and the following primers that are respectively located in each primer:
[0152] Primer
Primer sequence
SEQ ID
NO:
Gene-specific for reverse transcription
sex primer 1
TTCAGGCAGCGTCTTTCACAGCCAC
1
poly C anchor primer
(first round of PCR forward primer)
GGCCACGCGTCGACTAGTACGGGGGGGGGG
2
Gene-specific primer 2
(first round PCR reverse primer)
GGCACCTCCTTCAGGTCACTGATG
3
anchor primer
(Second round PCR forward primer)
GGCCACGCGTCGACTAGTAC
4
Gene-specific primer 3
(Second round PCR reverse primer)
GGTCTTGCCAGCAAAGCAGTAGTTG
5
[0153] In addition, the kit also includes an instruction manual illustrating the operation method of the RACE-like PCR combined sequencing method ...
Embodiment 3
[0162] Detection instance
[0163] Use the kit described in embodiment 2 to carry out ALK fusion gene detection to aforementioned 103 samples, 12 samples test results are positive for EML4-ALK fusion gene, detection rate is 11.6% (12 / 103), and each case result All are consistent with the previous detection results.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap