Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting gene fusion

A gene fusion and gene technology, applied in the field of detection, can solve the problems of not being able to detect the ALK fusion gene, affecting the detection rate of the ALK gene, and being difficult to detect the fusion at the same time

Inactive Publication Date: 2011-11-09
GUANGDONG GENERAL HOSPITAL +1
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Limitations of this method: 1) The gene that is fused with the ALK gene must be known; 2) The way the two genes are fused must be known; 3) It is impossible or difficult to detect the fusion of different genes with ALK at the same time
However, this method has limitations: 1) The gene fused with the ALK gene must be known; 2) The chromosomal position of the gene fused with ALK must be at a relatively short distance from ALK; 3) The occurrence of different genes with ALK cannot be detected at the same time. fusion of
Therefore, this method must design different probes for different genes fused with the ALK gene, and cannot detect unknown ALK fusion genes, which will affect the detection rate of the ALK gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting gene fusion
  • Method for detecting gene fusion
  • Method for detecting gene fusion

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0111] sample

[0112] The samples in this example come from 103 patients with non-small cell lung cancer who underwent surgery in Guangdong Provincial People's Hospital, and the obtained samples were used for the detection of ALK fusion gene. These samples were collected between 2004 and 2006 and included 62 adenocarcinomas, 29 squamous cell carcinomas, 11 large cell carcinomas, and 1 leiomyosarcoma. Informed consent was issued to each patient and the patient's consent was obtained. This study was approved by the Ethics Committee of Guangdong Provincial People's Hospital. All 103 samples are qualified samples and can be used for detection of ALK fusion gene.

[0113] RNA extraction

[0114] Total RNA was extracted using a commercially available RNeasy kit (purchased from QIAGEN, Valencia, CA). All samples were pathologically evaluated and the proportion of tumors was guaranteed to be no less than 80%.

[0115] Primer

[0116] The following primers were synthesized by ar...

Embodiment 2

[0150] Kit for detecting ALK fusion gene

[0151] Prepare a kit that can be used to detect ALK fusion gene, said kit includes five containers, and the following primers that are respectively located in each primer:

[0152] Primer

Primer sequence

SEQ ID

NO:

Gene-specific for reverse transcription

sex primer 1

TTCAGGCAGCGTCTTTCACAGCCAC

1

poly C anchor primer

(first round of PCR forward primer)

GGCCACGCGTCGACTAGTACGGGGGGGGGG

2

Gene-specific primer 2

(first round PCR reverse primer)

GGCACCTCCTTCAGGTCACTGATG

3

anchor primer

(Second round PCR forward primer)

GGCCACGCGTCGACTAGTAC

4

Gene-specific primer 3

(Second round PCR reverse primer)

GGTCTTGCCAGCAAAGCAGTAGTTG

5

[0153] In addition, the kit also includes an instruction manual illustrating the operation method of the RACE-like PCR combined sequencing method ...

Embodiment 3

[0162] Detection instance

[0163] Use the kit described in embodiment 2 to carry out ALK fusion gene detection to aforementioned 103 samples, 12 samples test results are positive for EML4-ALK fusion gene, detection rate is 11.6% (12 / 103), and each case result All are consistent with the previous detection results.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting gene fusion, and in particular provides a RACE-like PCR (polymerase chain reaction) joint sequencing detection method (RACE-like PCR joint sequencing method for short) for detecting fusion genes such as anaplastic lymphoma kinase (ALK) fusion gene and the like. By the method, different ALK fusion genes can be detected simultaneously, and unknown ALK fusion genes are detected under the condition of not knowing genes fused with ALK and the fusion modes of the ALK fusion genes in advance, so that the sensitivity, practicability and universality of the detection method are improved.

Description

technical field [0001] The invention relates to the field of detection, more specifically to a method, reagent and kit for detecting gene fusion. Background technique [0002] Studies have shown that in mammals such as humans, gene fusions are one of the causes of certain diseases such as cancer. [0003] Taking the anaplastic lymphoma kinase gene ("ALK" for short) as an example, the gene encodes a protein kinase receptor [1] . Activated ALK gene plays a role in anti-apoptosis and proliferation of cells through PIK3CA / AKT and MAPK pathways [2] . Ectopic ALK gene is more common in anaplastic lymphoma, neuroblastoma and myofibroma [3] . [0004] Ectopically generated fusion proteins of ALK function as oncogenes, retaining the intracellular kinase portion of ALK and incorporating the N-terminal portion of the protein fused to it. There are as many as 11 genes that have been reported to be fused with ALK, such as NPM [4] , EML4 [1] , MSN [5] ,TPM3 [6，7] , ATIC, TFG, CA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 吴一龙张绪超朱冠山张仕蓉
Owner GUANGDONG GENERAL HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com