Engineering bacterium containing 2-oxoglutarate decarboxylase gene kgd and applications thereof

A technology of engineering bacteria and genes, applied in the field of genetic engineering technology and fermentation, can solve the problems of high price, high cytotoxicity, complicated and complicated mixed carbon source fermentation strategy, etc., and achieve the effect of reducing production costs.

Inactive Publication Date: 2014-06-04
TIANJIN GREENBIO MATERIAL CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The structure of 4HB is similar to that of carbon sources, which are very expensive and highly toxic to cells. During the fermentation process, it is often necessary to add feed in batches, and the fermentation strategy of mixed carbon sources is also cumbersome and complicated.
For example, 4-hydroxybutyric acid is considered to be the most effective carbon source for incorporation of 4HB monomer into copolyesters, but it is a controlled drug in our country and it is difficult to buy it in the market in the form of chemicals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium containing 2-oxoglutarate decarboxylase gene kgd and applications thereof
  • Engineering bacterium containing 2-oxoglutarate decarboxylase gene kgd and applications thereof
  • Engineering bacterium containing 2-oxoglutarate decarboxylase gene kgd and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1, construction Escherichia coli genome integration plasmid pKD13km

[0040] 1. Digest the plasmid pKD13 with AceIII, recover the 2.5kb fragment by gel, and obtain the fragment containing the Km resistance gene and the R6kgamma replicon.

[0041] 2. Use the solutionI ligation kit of Takara (the solutionI kit is T4DNA ligase, and the product number in Takara company is D6022) to carry out self-ligation reaction to the fragment recovered in step 1 (the fragment and solutionI ratio after digestion are 1: 1), the ligation product was introduced into E.coli S17-1(λpir) by electroporation (Herrero, M, V.deLorenzo, and K.N.Timmis.1990.Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable Chromosomal insertion of foreign genes in gram-negative bacteria.J.Bacteriol.172:6557-6567), spread on LB-Km solid medium, and culture at 37°C for 16h.

[0042] 3. Plasmid verification: Pick a single clone from the LB-Km solid medium and p...

Embodiment 2

[0043] Example 2. Construction of genome integration expression vectors pUK series pUK162, pUK70, pUK63, pUK81 and pUK154.

[0044] 1. Under standard polymerase chain reaction conditions, use pEASY-Blunt as a template, primer P1: CCATCGCCCTGATAGACGGT (SalI) and primer P2: ACCTTTCCTTTTTCAATTCAGAAG (EcoRI) as upstream and downstream primers to amplify a 1365bp DNA fragment. Sequencing showed that this fragment contained the Km resistance gene. The Km resistance gene fragment was recovered after treatment with endonucleases EcoRI and SalI.

[0045] 2. Under standard polymerase chain reaction conditions, using pEASY-Blunt as a template, using primer P3: ATAAGAATTCGGCAACTATGGATGAACGAA (EcoR) and primer P4: ATATGTCGACTAATACGACTCACTATAGGGCGA (SalI) as upstream and downstream primers to amplify a 1409bp DNA fragment. Sequencing showed that the fragment contained the replicon sequence of pEASY-Blunt, and the replicon gene fragment was recovered after treatment with endonucleases EcoRI...

Embodiment 3

[0068] Embodiment 3, construction plasmid pBHR68orfZ

[0069] 1. Digest plasmid pCK3 with ClaI and EcoRI ( B, Gottschalk G. Molecular analysis of the anaerobic succinate degradation pathway in Clostridium kluyveri. J Bacteriol, 1996, 178: 871-880), a 1.8 kb fragment was recovered from the gel, which contained the orfZ gene and its promoter sequence.

[0070]2. Digest plasmid pBHR68 with ClaI and EcoRI (Spiekermann P, Rehm BHA, Kalscheuer R, et al. A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch Microbiol, 1999, 171: 73-80), the gel recovered a fragment of 8.1 kb, containing phaCAB gene and its promoter sequence, Amp resistance gene and replicon derived from pBluescript II SK (-).

[0071] 3. Use T4 DNA ligase to connect the fragments recovered in step 1 and step 2; after the ligation reaction is completed, the plasmid pBHR68orfZ is obtained, and the ob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
tensile strengthaaaaaaaaaa
lengthaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and fermentation, and particularly discloses an engineering bacterium for producing 3-hydroxybutyric acid and 4-hydroxybutyric acid copolyester (P3HB4HB) by utilizing a sugar carbon source. Exogenous genes needed for combining the P2HB4HB are recombined and integrated on the genome of the engineering bacterium and comprise poly-3-hydroxybutyrate synthetic gene phaCAB and 4-hydroxybutyryl coenzyme A which is transferase gene orfZ, 4-hydroxybutyric acid dehydrogenase gene 4hbD and 2-oxoglutarate dehydrogenase gene kgd. By utilization of the engineering bacterium, the P3HB4HB can be produced by using the sugar carbon source with relatively cheap price, the production cost is effectively reduced, and the large-scale industrial production and the commercial application and development are pushed.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and fermentation technology, and more specifically relates to an engineering bacterium for producing 3-hydroxybutyric acid and 4-hydroxybutyric acid copolyester (P3HB4HB) by using sugar carbon sources and its application. The exogenous gene required for the synthesis of P3HB4HB is recombined and integrated in the genome of the bacteria. Background technique [0002] Polyhydroxyalkanoates (polyhydroxyalkanoates, referred to as PHA) is a class of polymer biopolyesters widely present in microorganisms, mainly as carbon sources and energy storage substances in cells (Anderson AJ, Dawes EA. Occurrence, metabolism, metabolic role, and industrial use of bacterial polyhydroxyalkanoates. Microbiol Rev, 1990, 54: 450-472). Copolyester of 3-hydroxybutyrate (3-hydroxybutyrate, 3HB for short) and 4-hydroxybutyrate (4-hydroxybutyrate, 4HB for short) "3-hydroxybutyrate and 4-hydroxybutyrate copolym...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/62C12R1/19
Inventor陈国强吕渭川周子振
OwnerTIANJIN GREENBIO MATERIAL CO LTD