Check patentability & draft patents in minutes with Patsnap Eureka AI!

Kit for noninvasive detection of ovarian cancer susceptible gene

A detection kit and susceptibility gene technology, applied in the field of molecular biology, can solve problems such as loss of body metabolism and reduction

Inactive Publication Date: 2012-04-25
解码(上海)生物医药科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Normal GSTT1 enzyme activity may protect susceptible tissues and prevent DNA mutations in somatic cells by promoting the electrophilic effect of carcinogens and their elimination from the body, while the purity and deletion of GSTT1 gene may reduce or lose the body's metabolism and excretion of carcinogens function, which has a greater risk of tumor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for noninvasive detection of ovarian cancer susceptible gene
  • Kit for noninvasive detection of ovarian cancer susceptible gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Use of detection kit

[0021] 1. Extract DNA template

[0022] Scrape the epithelial cells of the oral mucosa of the subject, and extract the genomic DNA by phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) MTHFR (C677T) forward primer: 5'CATCCCTCGCCTTGAACAG3'MTHFR (C677T) reverse primer: 5'CAGACACTGTTGCTGGGTTTT3'

[0026] (2) GSTT1 (Null / Present) forward primer: 5'TTCCTTACTGGTCCTCACATCTC3'GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'

[0027] (3) CYP1B1 (Leu432Val) forward primer: 5'TTGTGCCTGTCACTATTCCTCA3'CYP1B1 (Leu432Val) reverse primer: 5'AGCCAGGATGGAGATGAAGAG3'

[0028] The PCR amplification reaction system is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl, ddH2O 19.175μl;

[0029] The reaction conditi...

Embodiment 2

[0043] Example 2. Service of non-invasive genetic testing for people to prevent the onset of ovarian cancer

[0044] 1. Sampling and extraction of DNA

[0045] Instructed by hospital laboratory physicians to use oral sampling swabs for oral epithelial cell sampling, and phenol-chloroform method for oral epithelial cell DNA extraction

[0046] 2. Genotyping

[0047] Using the kit provided by the present invention, DNA sequencing is performed on the C677T of the MTHFR gene of the subject's genomic DNA, whether the GSTT1 gene is missing (Null / Present), and the three SNPs of Leu432Val on the CYP1B1 gene. , To determine the genotypes of these 3 SNPs.

[0048] 3. Risk assessment of high-risk groups of ovarian cancer

[0049] Through the analysis of the SNPs genotype of the subject, a risk assessment analysis report of ovarian cancer susceptibility genes is issued. The report details whether C677T on the MTHFR gene of the subject, whether the GSTT1 gene is missing (Null / Present), the SNP locu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for noninvasive detection of an ovarian cancer susceptible gene. The kit comprises specific primers and DNA sequencing primers for detecting whether C677T and GSTT1 genes on MTHFR gene are null or present, and for detecting the genotype of 3 mononucleotide polymorphism sites of Leu432Val on CYP1B1 gene, a PCR (polymerase chain reaction) reaction assembly, a PCR product purification assembly, and a DNA sequencing reaction assembly, etc. The kit of the invention assesses the risk grade of ovarian cancer suffering by women through detecting the genotype of 3 mononucleotide polymorphism sites closely related to ovarian cancer occurrence, and finally guides women in targeted prevention of ovarian cancer occurrence in a gene level according to the gene detection result of each examinee, thus lowering the morbidity of ovarian cancer. The invention adopts an oral mucosa cell sampling method, which is painless and noninvasive, and avoids cross infection. The kit of the invention has precise and reliable detection results, so that there is no need to purchase expensive special imported equipment, and the method of the kit is very easy to popularize and promote.

Description

Technical field [0001] The invention belongs to the field of molecular biology, and relates to medicine and biotechnology, and specifically relates to a ovarian cancer susceptibility gene detection kit, which evaluates the risk level of ovarian cancer from the genetic level according to the detection results, and serves as a direction for the prevention and treatment of ovarian cancer guide. Background technique [0002] Ovarian cancer is one of the common tumors of female reproductive organs, the incidence rate is second only to cervical cancer and uterine body cancer and ranks third. However, the deaths caused by ovarian cancer are the first of all types of gynecological tumors, posing a serious threat to women’s lives. Ovarian cancer is the gynecological malignant tumor with the highest mortality rate because of its insidious onset and rapid progress. 70%-80% of ovarian cancer patients are already at an advanced stage when discovered, and the 5-year survival rate is only 20%-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More