Unlock instant, AI-driven research and patent intelligence for your innovation.

Identification and application of specific expression promoter of plant root

A promoter and plant technology, which is applied in the field of plant bioengineering and plant improvement genetic engineering, can solve the problems of plant growth and development, the effect of time and space improvement of target gene expression is not obvious, and the waiting time is long.

Inactive Publication Date: 2012-05-23
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some strong constitutive promoters are widely used in the field of agricultural biotechnology, such as the CaMV 35S promoter and the maize Ubiquitin-1 promoter (Battraw and Hall, 1990; Christensen et al.1992). When sub-inducing the target gene to transform crops such as rice in order to improve the quality of the crop, the improvement effect is often not obvious because the time (developmental stage specificity) or space (tissue and organ specificity) of the target gene expression cannot be well controlled, or Because these constitutive promoters induce too high gene expression and affect the growth and development of plants, these are the obstacles encountered when using constitutive strong promoters combined with functional genes to improve crop quality.
[0003] In addition, when studying certain metabolic processes or regulatory pathways, it is often necessary to transform two or more genes on the same pathway into the same line, transforming one of the genes to obtain a transgenic plant and then transforming another gene, or It takes a long time to wait for the hybridization after the two genes have been transformed separately. In order to improve the efficiency and shorten the time for transforming multiple genes, it has recently been reported that a new vector can be used to simultaneously transform multiple genes (Lin et al. 2003; Chen et al.2006), but if the same promoter is used repeatedly during multigene transformation, gene silencing may also occur due to the high homology of the promoter sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification and application of specific expression promoter of plant root
  • Identification and application of specific expression promoter of plant root
  • Identification and application of specific expression promoter of plant root

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The methods used in the following examples are conventional methods unless otherwise specified. The primers used were synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and the sequencing was completed by Beijing Huada Gene. Zibao Bioengineering Co., Ltd., pEASY-T1 ligation kit was purchased from Beijing Quanshijin Biotechnology Company, and T4 DNA ligase was purchased from Promega Company. The methods were all carried out according to the methods provided in the kit. The carrier pHPG used in the experiment was transformed from this experiment, and the basic skeleton came from pCAMBIA1303 of CAMBIA Company.

[0028] 1. Isolation and identification of promoter KT630P

[0029] Design the primers required for cloning the promoter KT630P:

[0030] Primer 1: 5′-CCCaagctt GCTATATGTGTACGTGATAGTATAT -3′

[0031] Primer 2: 5′CGggatcc TTAATTTGCTCTTGTATTAGCTTCTA -3′

[0032] The sequence aagctt in primer 1 is the restriction site for HindIII, and the sequence ggatcc i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating the expression of an exogenous nucleotide sequence in a plant body and a DNA (Deoxyribonucleic Acid) construct. The DNA construct contains a new nucleotide sequence of a specific expression promoter of a plant root. The invention further provides a method for preferentially expressing the exogenous nucleotide sequence in the plant root by using the specific expression promoter of the root, disclosed by the invention.

Description

technical field [0001] The invention belongs to the technical fields of plant bioengineering and plant improvement genetic engineering, and specifically relates to the isolation, identification and application of a plant root-specific expression promoter. Background technique [0002] The exogenous DNA sequence is linked to a specific promoter to promote expression in the plant host, and the choice of the promoter type determines the time and location of gene expression. At present, some strong constitutive promoters are widely used in the field of agricultural biotechnology, such as the CaMV 35S promoter and the maize Ubiquitin-1 promoter (Battraw and Hall, 1990; Christensen et al.1992). When sub-inducing the target gene to transform crops such as rice in order to improve the quality of the crop, the improvement effect is often not obvious because the time (developmental stage specificity) or space (tissue and organ specificity) of the target gene expression cannot be well ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/82C12N15/113
CPCC07K14/415C12N15/8227
Inventor 李早霞周君莉夏勉
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED