Identification and application of specific expression promoter of plant root
A promoter and plant technology, which is applied in the field of plant bioengineering and plant improvement genetic engineering, can solve the problems of plant growth and development, the effect of time and space improvement of target gene expression is not obvious, and the waiting time is long.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The methods used in the following examples are conventional methods unless otherwise specified. The primers used were synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and the sequencing was completed by Beijing Huada Gene. Zibao Bioengineering Co., Ltd., pEASY-T1 ligation kit was purchased from Beijing Quanshijin Biotechnology Company, and T4 DNA ligase was purchased from Promega Company. The methods were all carried out according to the methods provided in the kit. The carrier pHPG used in the experiment was transformed from this experiment, and the basic skeleton came from pCAMBIA1303 of CAMBIA Company.
[0028] 1. Isolation and identification of promoter KT630P
[0029] Design the primers required for cloning the promoter KT630P:
[0030] Primer 1: 5′-CCCaagctt GCTATATGTGTACGTGATAGTATAT -3′
[0031] Primer 2: 5′CGggatcc TTAATTTGCTCTTGTATTAGCTTCTA -3′
[0032] The sequence aagctt in primer 1 is the restriction site for HindIII, and the sequence ggatcc i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 