Nucleic acid marker for gel electrophoresis as well as preparation method and application thereof

A technique of gel electrophoresis and markers, which is applied in biochemical equipment and methods, DNA preparation, microbial measurement/inspection, etc. It can solve the problems of high technical requirements for operators, difficulty in inactivation, lack of molecular markers, etc., and achieve Expand the effect of the application

Inactive Publication Date: 2014-02-12
NO 3 PEOPLE HOSPITAL AFFILIATED TO SHANGHAI JIAOTOG UNIV SCHOOL OF MEDICINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since RNase is ubiquitous and difficult to inactivate, it is usually necessary to strictly handle the equipment used before operation, which requires high technical requirements for operators, which greatly limits the application of RNA molecular markers
However, polyacrylamide gel electrophoresis without denaturing agents (such as urea, formamide, etc.) to separate RNA fragments below 100nt, especially microRNAs (miRNAs) around 20nt, lacks effective molecular markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid marker for gel electrophoresis as well as preparation method and application thereof
  • Nucleic acid marker for gel electrophoresis as well as preparation method and application thereof
  • Nucleic acid marker for gel electrophoresis as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Single-stranded DNA sequences and RNA sequences with different numbers of nucleotides were selected, wherein the single-stranded NDA sequences were 10nt, 21nt, 40nt, 88nt, and the single-stranded RNA sequences were 21nt, 40nt, respectively. The single-stranded DNA sequence is as follows:

[0056] 10nt DNA sequence (5'-3'):

[0057] atgtagagct SEQ ID No.1

[0058] 10ntDNA Complementary Sequence (5′-3′):

[0059] agctctacat SEQ ID No.2

[0060] 21nt DNA sequence (5'-3'):

[0061] accccagtagccagatgtagct SEQ ID No.3

[0062] 21nt DNA Complementary Sequence (5′-3′):

[0063] agctacatctggctactgggt SEQ ID No.4

[0064] 40nt DNA sequence (5'-3'):

[0065] atcgttccaattttagtatatgtgctgccgaagcgaggct SEQ ID No.5

[0066] 40nt DNA Complementary Sequence (5′-3′):

[0067] agcctcgcttcggcagcacatatactaaaattggaacgat SEQ ID No.6

[0068] 88nt DNA sequence (5'-3'):

[0069] aaccatgacctcaagaacagtatttccaggaatccccatcttagcatctaagggattcctgggaaaactggaccgtgaggacaaggct SEQ ID No. 7

[...

Embodiment 2

[0100]Taking the detection of microRNA (about 20nt) as an example, the method of non-denaturing PAGE electrophoresis using the molecular control prepared in the above example is as follows: the miRNA probe is hybridized with the total RNA in liquid phase, and the length of the double strand after hybridization is about 40nt. (2μM), 21nt (4μM), 40nt (4μM), 88nt (2μM) single-stranded DNA molecule controls were electrophoresed on non-denaturing polyacrylamide gel. Determine the migration of the hybrid strand of the miRNA probe and the target nucleic acid (nucleic acid to be tested) in non-denaturing polyacrylamide gel electrophoresis.

[0101] The result is as Figure 4 As shown, it can be seen that the miRNA probe and the target nucleic acid hybridization band are separated from the non-hybridization probe band. It shows that the molecular control substance prepared in the above examples of the present invention can be used for non-denaturing PAGE electrophoresis to detect miRN...

Embodiment 3

[0103] Example of RNA-DNA double-strand detection

[0104] Taking the detection of small RNA U6 (about 100nt) as an example, the method of non-denaturing PAGE electrophoresis using the molecular control prepared in the above example is as follows: the U6 probe is hybridized with the total RNA in liquid phase, and the hybridized band is about 120nt. , 80nt (each 2μM) RNA-DNA double-stranded molecule control object was electrophoresed on non-denaturing polyacrylamide gel. Determine the migration of the hybrid strand between the U6 probe and the target nucleic acid (nucleic acid to be tested) in non-denaturing polyacrylamide gel electrophoresis.

[0105] The result is as Figure 5 As shown, it can be seen that the hybridization band between the U6 probe and the target nucleic acid appears above 80 nt of the RNA-DNA double-stranded control object. It shows that the molecular controls prepared in the above examples of the present invention can be used for non-denaturing PAGE elec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleic acid marker for polyacrylamide gel electrophoresis, a preparation method of the nucleic acid marker for gel electrophoresis, and a method for using the nucleic acid marker for gel electrophoresis to detect nucleic acid of gel electrophoresis. The nucleic acid marker for gel electrophoresis comprises a single-stranded DNA (deoxyribonucleic acid) and further comprises a DNA- DNA double strand and / or DNA- RNA (Ribonucleic Acid) hybridized double strand; wherein, base numbers of two single-stranded DNAs in the DNA-DNA double strand are the same and the bases are complementary; and base number of a single-stranded DNA and that of a single-stranded RNA in the DNA- RNA double strand are the same, and the bases are complementary. The nucleic acid marker can be used for molecule comparison of non-denaturing PAGE (polyacrylamide gel electrophoresis) after solution hybridization and is particularly suitable for detection of 200bp nucleic acid.

Description

technical field [0001] The invention relates to a non-denaturing polyacrylamide gel (PAGE) electrophoresis nucleic acid marker, in particular to a nucleic acid marker which can be used for analyzing and separating small molecular nucleic acid PAGE electrophoresis, and a preparation method and application thereof. Background technique [0002] Gel electrophoresis (Gel electrophoresis) is a type of technology used to separate and analyze molecules with different physical properties. This method is simple and fast, and can distinguish DNA and RNA fragments that cannot be classified by other methods. Therefore, it is widely used in molecular biology, Genetics and biochemistry, through the detection of different bands, the location of the nucleic acid can be determined for further analysis or recovery. [0003] Gel electrophoresis of nucleic acids generally uses agarose or polyacrylamide gel (PAGE), among which, polyacrylamide gel has a higher resolution and can effectively separ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
Inventor高丰厚时婧郭跃辉姜斌
OwnerNO 3 PEOPLE HOSPITAL AFFILIATED TO SHANGHAI JIAOTOG UNIV SCHOOL OF MEDICINE