Nucleic acid marker for gel electrophoresis as well as preparation method and application thereof
A technique of gel electrophoresis and markers, which is applied in biochemical equipment and methods, DNA preparation, microbial measurement/inspection, etc. It can solve the problems of high technical requirements for operators, difficulty in inactivation, lack of molecular markers, etc., and achieve Expand the effect of the application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Single-stranded DNA sequences and RNA sequences with different numbers of nucleotides were selected, wherein the single-stranded NDA sequences were 10nt, 21nt, 40nt, 88nt, and the single-stranded RNA sequences were 21nt, 40nt, respectively. The single-stranded DNA sequence is as follows:
[0056] 10nt DNA sequence (5'-3'):
[0057] atgtagagct SEQ ID No.1
[0058] 10ntDNA Complementary Sequence (5′-3′):
[0059] agctctacat SEQ ID No.2
[0060] 21nt DNA sequence (5'-3'):
[0061] accccagtagccagatgtagct SEQ ID No.3
[0062] 21nt DNA Complementary Sequence (5′-3′):
[0063] agctacatctggctactgggt SEQ ID No.4
[0064] 40nt DNA sequence (5'-3'):
[0065] atcgttccaattttagtatatgtgctgccgaagcgaggct SEQ ID No.5
[0066] 40nt DNA Complementary Sequence (5′-3′):
[0067] agcctcgcttcggcagcacatatactaaaattggaacgat SEQ ID No.6
[0068] 88nt DNA sequence (5'-3'):
[0069] aaccatgacctcaagaacagtatttccaggaatccccatcttagcatctaagggattcctgggaaaactggaccgtgaggacaaggct SEQ ID No. 7
[...
Embodiment 2
[0100]Taking the detection of microRNA (about 20nt) as an example, the method of non-denaturing PAGE electrophoresis using the molecular control prepared in the above example is as follows: the miRNA probe is hybridized with the total RNA in liquid phase, and the length of the double strand after hybridization is about 40nt. (2μM), 21nt (4μM), 40nt (4μM), 88nt (2μM) single-stranded DNA molecule controls were electrophoresed on non-denaturing polyacrylamide gel. Determine the migration of the hybrid strand of the miRNA probe and the target nucleic acid (nucleic acid to be tested) in non-denaturing polyacrylamide gel electrophoresis.
[0101] The result is as Figure 4 As shown, it can be seen that the miRNA probe and the target nucleic acid hybridization band are separated from the non-hybridization probe band. It shows that the molecular control substance prepared in the above examples of the present invention can be used for non-denaturing PAGE electrophoresis to detect miRN...
Embodiment 3
[0103] Example of RNA-DNA double-strand detection
[0104] Taking the detection of small RNA U6 (about 100nt) as an example, the method of non-denaturing PAGE electrophoresis using the molecular control prepared in the above example is as follows: the U6 probe is hybridized with the total RNA in liquid phase, and the hybridized band is about 120nt. , 80nt (each 2μM) RNA-DNA double-stranded molecule control object was electrophoresed on non-denaturing polyacrylamide gel. Determine the migration of the hybrid strand between the U6 probe and the target nucleic acid (nucleic acid to be tested) in non-denaturing polyacrylamide gel electrophoresis.
[0105] The result is as Figure 5 As shown, it can be seen that the hybridization band between the U6 probe and the target nucleic acid appears above 80 nt of the RNA-DNA double-stranded control object. It shows that the molecular controls prepared in the above examples of the present invention can be used for non-denaturing PAGE elec...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com