Application of OsDCL3b in dwarf rice cultivation
A rice and dwarf technology, applied in recombinant DNA technology, using vectors to introduce foreign genetic material, cells modified by introducing foreign genetic material, etc., can solve the problems of abnormal accumulation of miRNA, abnormal ovary development, delayed flowering, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Construction of pCAMBIA2300-OsDCL3bIR vector
[0020] 1. Transformation of pUCRNAi vector:
[0021] The pUCRNAi vector is transformed on the basis of the pUC18 vector, and is constructed according to the following method: the pUC18 vector is passed through Bam H I and EcoR After I digestion, it was filled up by T4 polymerase, using potato genomic DNA as a template, using forward primer: CCT GCA GGC TCG AGA CTA GTA GAT CTG GTA CGG ACC GTA CTA CTC TA and reverse primer: CCT GCA GGG TCG ACT CTA GAG GAT CCC CTA TAT AAT TTA AGT GGA AAA PCR amplification of introns in potato GA20 oxidase. Insert the amplified product into the pUC18 vector with blunt ends Bam H I and EcoR Between the I sites, the pUCRNAi vector was obtained.
[0022] 2. Transformation of pCAMBIA2300ACT vector:
[0023] pCAMBIA2300ACT is constructed on the basis of the pCAMBIA2300 (CAMBIA company) carrier, and the specific method is as follows: take the genomic DNA of rice Nipponbare as ...
Embodiment 2
[0027] The acquisition of embodiment two dwarf rice
[0028] The recombinant expression vector pCAMBIA2300- OsDCL3bIR via genknonggan( Agrobacterium tume faciens ) strain AGL1 is mediated into rice Nipponbare mature seed callus, and when the shoots differentiated from the callus grow to 3-5cm, the shoots are cut off, and the rooting medium ( MS+25mg / L glufosinate-ammonium), 26±1°C light cultivation and rooting, to obtain T0 generation transgenic plants; seedlings grow to about 8-10cm high, open the culture bottle for 1-2 days, wash off the root plant gel , planted in the field, conventional management.
[0029]The transformed plants were verified by PCR whether the neomycin phosphotransferase II (NPTII) gene existed to verify whether the transgene was successful. Using the genomic DNA of the plant as a template, using primers: CX637 (5' GATTGAACAAGATGGATTGCACGCAGGTT3') and CX638 (5' CAGAAGAACTCGTCAAGAAGGCGATAGAA 3' ) PCR amplification to obtain a 666bp neomycin pho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 