Application of OsDCL3b in dwarf rice cultivation

A rice and dwarf technology, applied in recombinant DNA technology, using vectors to introduce foreign genetic material, cells modified by introducing foreign genetic material, etc., can solve the problems of abnormal accumulation of miRNA, abnormal ovary development, delayed flowering, etc.

Inactive Publication Date: 2012-07-11
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Weak dcll mutants exhibit various developmental defects, such as altered leaf shape, delayed flowering, a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsDCL3b in dwarf rice cultivation
  • Application of OsDCL3b in dwarf rice cultivation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Construction of pCAMBIA2300-OsDCL3bIR vector

[0020] 1. Transformation of pUCRNAi vector:

[0021] The pUCRNAi vector is transformed on the basis of the pUC18 vector, and is constructed according to the following method: the pUC18 vector is passed through Bam H I and EcoR After I digestion, it was filled up by T4 polymerase, using potato genomic DNA as a template, using forward primer: CCT GCA GGC TCG AGA CTA GTA GAT CTG GTA CGG ACC GTA CTA CTC TA and reverse primer: CCT GCA GGG TCG ACT CTA GAG GAT CCC CTA TAT AAT TTA AGT GGA AAA PCR amplification of introns in potato GA20 oxidase. Insert the amplified product into the pUC18 vector with blunt ends Bam H I and EcoR Between the I sites, the pUCRNAi vector was obtained.

[0022] 2. Transformation of pCAMBIA2300ACT vector:

[0023] pCAMBIA2300ACT is constructed on the basis of the pCAMBIA2300 (CAMBIA company) carrier, and the specific method is as follows: take the genomic DNA of rice Nipponbare as ...

Embodiment 2

[0027] The acquisition of embodiment two dwarf rice

[0028] The recombinant expression vector pCAMBIA2300- OsDCL3bIR via genknonggan( Agrobacterium tume faciens ) strain AGL1 is mediated into rice Nipponbare mature seed callus, and when the shoots differentiated from the callus grow to 3-5cm, the shoots are cut off, and the rooting medium ( MS+25mg / L glufosinate-ammonium), 26±1°C light cultivation and rooting, to obtain T0 generation transgenic plants; seedlings grow to about 8-10cm high, open the culture bottle for 1-2 days, wash off the root plant gel , planted in the field, conventional management.

[0029]The transformed plants were verified by PCR whether the neomycin phosphotransferase II (NPTII) gene existed to verify whether the transgene was successful. Using the genomic DNA of the plant as a template, using primers: CX637 (5' GATTGAACAAGATGGATTGCACGCAGGTT3') and CX638 (5' CAGAAGAACTCGTCAAGAAGGCGATAGAA 3' ) PCR amplification to obtain a 666bp neomycin pho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for cultivating dwarf rice by utilizing Dicer protein OsDCL3b in rice. In the method, the expression of an OsDCL3b gene in a rice cell is inhibited by utilizing a transgene, specially, the expression of the OsDCL3b gene in the rice is inhibited by utilizing a RNA (ribonucleic acid) interference technology so as to obtain the dwarf rice. The method has important significance in lodging resistance of rice and has wide application prospect.

Description

technical field [0001] The invention belongs to the technical field of plant transgenesis, and relates to a method for cultivating dwarf rice by inhibiting the expression of OsDCL3b gene in rice. Background technique [0002] Rice is an important food crop in my country, and its yield and quality are crucial to my country's food production and food security. In recent years, the global climate has changed, typhoons and hurricanes have increased, and rice lodging has been serious, which has greatly reduced the yield and quality of rice. my country's grain production is facing a severe test. Generally speaking, the lodging phenomenon of high-stalk rice is more serious, and the lodging resistance of dwarf-stalk rice is relatively strong. Therefore, cultivating short-stalk rice can reduce the lodging rate of rice, increase yield, and improve quality. It is one of the hot issues in modern rice breeding. one. With the advancement of science and technology, molecular biology is p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/09C12N15/82C12N5/10
Inventor 曹晓风宋显伟刘斌刘春艳储成才
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap