Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes

A detection kit and susceptibility gene technology, applied in the field of molecular biology, can solve the problems of increasing and increasing the concentration of environmental toxins and carcinogens, and lack of polymorphism in the population.

Inactive Publication Date: 2012-07-18
解码(上海)生物医药科技有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the deletion of GSTT1 and GSTM1 genes leads to the deletion of their encoded isozymes, which may affect the body's detoxification function against the above-mentioned poisons and increase the host's sensitivity to the effects of carcinogens
Studies have shown that there are deletion polymorphisms in GSTM1 and GSTT1, and the deletion rate varies in different regions. The deletion rate of GSTM1 in Chinese is high, ranging from 35% to 63%, especially the deletion rate of GSTT1 is as high as 58%. This part of the population is equivalent to an increase of Concentrations of environmental toxins and carcinogens that increase an individual's risk of developing a range of types of cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes
  • Noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes
  • Noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Use of detection kits

[0021] 1. Extract DNA template

[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) CYP2E1 (Rsal1) forward primer: 5′AAGTGATTTGGCTGGATTGTA3′

[0026] CYP2E1 (Rsal1) reverse primer: 5'ATACAGACCCTCTTCCACCTT3'

[0027] (2) TNF-β (G252A) forward primer: 5'CAGAAGGAGGAGGTGTAGGGT3'

[0028] TNF-β (G252A) reverse primer: 5'TTCGTGCTTTGGACTACCG3'

[0029] (3) GSTM1 (Null / Present) forward primer: 5'GAACTCCCTGAAAAGCTAAAGC3'

[0030] GSTM1 (Null / Present) reverse primer: 5'GTTGGGCTCAAATACGGTGG3'

[0031] (4) GSTT1 (Null / Present) forward primer: 5'TTCCTTACTGGTCCTCACATCTC3'

[0032] GSTT1 (Null / Present) reverse primer: 5′TCACCGGATCATGGCCAGCA3′

[0033] The reaction system of PCR amplif...

Embodiment 2

[0049] Example 2. The service of non-invasive detection of genes for the prevention of nasopharyngeal carcinoma

[0050] 1. Sampling and DNA extraction

[0051] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0052] 2. Genotype detection

[0053] Using the kit provided by the present invention, the Rsal1 polymorphism on the CYP2E1 gene of the subject's genomic DNA, the G252A site polymorphism on the TNF-β gene, whether the GSTM1 gene is missing (Present / Null), the GSTT1 gene deletion and No (Present / Null) 4 single nucleotide polymorphism loci were subjected to DNA sequencing respectively to determine the genotypes of these 4 SNPs loci.

[0054] 3. Risk assessment of high-risk groups for nasopharyngeal carcinoma

[0055] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes. The kit comprises a specific primer, a DNA sequencing primer, a PCR (Polymerase Chain Reaction) component, a PCR product purification component, a DNA sequencing reaction component and the like, wherein the specific primer is used for detecting the polymorphic site genotypes of four mononucleotides of the Rsall polymorphism on a CYP2E1 gene, the polymorphism of a G252 site on a TNF (Tumor Necrosis Factor)-alpha gene, the deletion (Present / Null) of a GSTM (Giant Solide Turner Of The Mediastinum) 1 gene and the deletion (Present / Null) of a GSTT (Gross Saponin From Tribulus Terrestris) 1 gene. According to the kit, the risk level of nasopharyngeal carcinoma of a subject is evaluated according to the genotypes of two mononucleotide polymorphic sites closely related to the nasopharyngeal carcinoma, and then, according to the gene detection results of each subject, the subjects are guided from the gene level to specifically prevent the nasopharyngeal carcinoma so as to reduce the morbidity risk rate of the nasopharyngeal carcinoma. The sampling method of the kit adopts oral mucosal cell sampling which is painless and non-invasive, and cross-infections are avoided. The sequencing detection result of the kit is accurate and reliable, and is easy to popularize because expensive import special instruments are not needed to be purchased.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a nasopharyngeal cancer susceptibility gene detection kit, which evaluates the risk level of nasopharyngeal cancer from the genetic level according to the detection results, and serves as a method for preventing and treating nasopharyngeal cancer. Cancer direction guide. Background technique [0002] Nasopharyngeal carcinoma refers to malignant tumors that occur on the roof and side walls of the nasopharyngeal cavity. Common clinical symptoms are nasal congestion, nasal discharge bleeding, headache, and tinnitus; late-stage invasion of the brain, tinnitus, deafness, headache, diplopia, and cervical lymphadenopathy may occur. In most countries in the world, the incidence of nasopharyngeal carcinoma is extremely low, but it is very high in some provinces and cities in southern China and some countries in southeastern Asia. Among th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products