Biological sequence local comparison method capable of obtaining complete solution

A technology of biological sequence and local alignment, applied in the field of database and bioinformatics, which can solve the problem of inability to guarantee

Active Publication Date: 2012-10-24
NORTHEASTERN UNIV
View PDF2 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method has high efficiency, it also cannot guarantee to find all eligible results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological sequence local comparison method capable of obtaining complete solution
  • Biological sequence local comparison method capable of obtaining complete solution
  • Biological sequence local comparison method capable of obtaining complete solution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1 of the present invention uses two sets of DNA sequences to form T and P respectively, as follows:

[0057] T=GCTAACTGCTAGCTGCGAGTTACC

[0058] P=GCTACCTGCTAGCTGCTAGCTGTG

[0059] Step 2: Align the suffix tree branch of the reference sequence with the query sequence, the steps are as follows:

[0060] Step 2.1: The user sets Sa=1Sb=-3Sg=-5Ss=-2H=7 by himself;

[0061] Step 2.2: The reverse sequence T of the reference sequence T -1 Build BWT index;

[0062] The inverse sequence T of the reference sequence -1 =CCATTGAGCGTCGATCGTCAATCG

[0063] Simulate suffix tree traversal through BWT index to build BWT index, the steps are as follows:

[0064] Step 2.2.1: At T -1 Add a special character $ at the end to make the character smaller than T -1 All characters in the sequence, in the following form:

[0065] CCATTGAGCGTCGATCGTCAATCG$

[0066] Step 2.2.2: For T -1 The suffix array of is sorted lexicographically;

[0067]

[0068] Among them, the corre...

Embodiment 2

[0166] The reference sequence T is extracted from the human gene sequence (GRCh37), with a size of 1Gb, and the query sequence P is extracted from the first chromosome of the mouse gene (MGSCv37chr1), with different lengths, and 100 sequences are extracted from random positions for each length.

[0167] Carry out the method of the present invention to above-mentioned two sequences, step is as follows:

[0168] Step 1: Use one biological sequence as the reference sequence T, and another biological sequence as the query sequence P;

[0169] Because the amount of data is too large, a suffix X of T, that is, a branch of the suffix tree is taken as an example to illustrate the implementation process.

[0170] X=ATGCCTGATGCATGATACAGGCTT

[0171] P=ATGCTTGATGCATGATGCATGAGA

[0172] Step 2: Align the suffix tree branch of the reference sequence with the query sequence, the steps are as follows:

[0173] Step 2.1: The user sets Sa=1Sb=-3Sg=-5Ss=-2H=7 by himself;

[0174] Step 2.2: ...

Embodiment 3

[0266] In this example, the genomes of three kinds of Streptomyces were used for local comparison, namely, the genome of Streptomyces coelicolor (S. coelicolor) with a full length of 8,667,507 bp; Mb; the linear chromosome of Streptomyces griseus (S. griseus), the full length is 8,545,929bp. Because the amount of data is too large, a small segment in the calculation process is taken as an example.

[0267] Steps 1 to 2 are similar to Embodiment 1 and Embodiment 2, so details are not repeated here.

[0268] Take a small fragment in the calculation process as an example, that is

[0269] X=TGACCGATGACTGATGTCTAACGG

[0270] P=TGACGGATGACTGATGACTGATAT

[0271] Step 3: Integrate the results of each branch to obtain the final comparison result of the two biological sequences;

[0272] (1) Query: TGACGGATGAC

[0273] Subject: TGACCGATGAC

[0274] Score: 7

[0275] (2) Query: TGACGGATGACT

[0276] Subject: TGACCGATGACT

[0277] Score: 8

[0278] (3) Query: TGACGGATGACTG

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is a biological sequence local comparison method capable of obtaining a complete solution. The method includes adopting one biological sequence as a reference sequence and another biological sequence as a query sequence and setting a match score as Sa, a mismatch score as Sb, a gap opening penalty as Sg, a gap extension penalty as Ss and a fraction threshold as H; comparing suffix tree branches of the reference sequence with the query sequence; integrating comparison score results of each branch and taking a maximum score as a final comparison score result of the two biological sequences; and according to the final comparison score result, searching fragments provided with similar functions in the query sequence and the reference sequence or determining a homology relation between the query sequence and the reference sequence. According to the method, a Burrows-Wheeler transform (BWT) index is adopted, filtering and reuse technologies are combined to perform the comparison of the suffix tree branches of the reference sequence with the query sequence so as to obtain the complete solution for the comparison of the biological sequences, and the problems of insufficient accuracy and low efficiency in the prior art are solved.

Description

technical field [0001] The invention belongs to the field of database and bioinformatics, and in particular relates to a method for local comparison of biological sequences that can obtain complete solutions. Background technique [0002] In bioinformatics research, it is often necessary to compare the obtained gene or protein sequence (set as P) with the known biological sequence (set as T). In many cases, T and P may not be similar as a whole, but they may contain very similar subsequences. The purpose of local alignment is to find such subsequences with high similarity. Local comparison technology has important applications in bioinformatics research, such as gene and protein function research, species homology research, etc. Locally compare two different gene sequences, and analyze the similar subsequences of the two, so as to find the gene fragments with similar functions in the two gene sequences. By comparing the newly discovered protein sequence with the protein s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G06F19/22
Inventor杨晓春王斌刘洪磊王佳英
OwnerNORTHEASTERN UNIV