Novel gene of sorting nexin (SNX) family and use thereof
An amino acid and oligonucleotide technology, applied in the field of SNX11 gene and its application, can solve the problems of SNX family that need to be improved
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0119] Embodiment 1: Amplification of SNX11 gene
[0120] RNA was extracted from HEK293T cells and reverse transcribed into cDNA. According to the human SNX11 sequence published by Genbank (NCBI gene ID: 29916), primers were designed to amplify the SNX11 gene fragment in 293T cDNA, and then ligated into the PCR3.1-GFP-flag vector.
[0121] Primers used for amplification:
[0122] hSNX11U: ATGGGCTTTTGGTGTAGGATGTCGG (SEQ ID NO: 6)
[0123] hSNX11L: CTTTTCCAAAACTGTTTCTAACTGACCAGGG (SEQ ID NO: 7)
[0124] The PCR product was ligated into the EcoRV site of the PCR3.1 vector, and the vector upstream primer T7 (TAATACGACTCACTATAGGG (SEQ ID NO: 8)) and the SNX11 downstream primer hSNX11L were used to identify the direction of gene insertion, and sequenced to identify the sequence. Finally, the PCR3.1-hSNX11-GFP-flag eukaryotic expression vector was constructed for expressing SNX11 in mammalian cells.
Embodiment 2
[0125] Embodiment 2: Analysis of SNX11 crystal
[0126] Protein Expression and Purification
[0127] The inventors constructed two SNX11 fragments for the structural research of SNX11. One of them is SNX11-142C with residues 7-142 and the other is SNX11-170C with residues 7-170. These two cDNA fragments were inserted into pET21a and verified by sequencing. Proteins were expressed in Rosetta2(DE3) cells grown on LB medium. Among them, when OD 600 When the value of 0.6-0.8, at 16 ℃, the cells were induced with 0.3 mm of IPTG for 22 hours, the expression of SNX11-142C in the cells; when OD 600 The expression of SNX11-170C in the cells was induced by 0.3 mM IPTG for 14 hours at 25°C when the value of α was 0.6-0.8. Bacteria were collected by centrifugation, washed, and resuspended in lysate (20 mM Tris-HCl, pH 8.0, 300 mM NaCl, 7 mM β-mercaptoethanol) at 4°C. Cells were then lysed by 3 sonications. Finally, using the standard protocol Ni 2+ SNX11-142C was purified on an af...
Embodiment 3
[0130] Example 3: Research on the functions of SNX11 and SNX10
[0131] 1. SNX11 inhibits the maturation of late endosomes (LE)
[0132]The inventors first transfected the constructed SNX11 eukaryotic expression vector in cells. It was found that the overexpression of SNX11 in Hela cells did not cause the vacuolization phenomenon similar to that of SNX10. On the contrary, when SNX11 and SNX10 vectors were simultaneously transfected into Hela cells, the inventors found that the vacuoles caused by SNX10 were significantly inhibited ( figure 1 , A). By labeling different endosomal forms with Rabs, the inventors found that in cells expressing SNX10, the surface of vacuoles were all marked by Rab7. This indicates that the role of SNX10 is to promote the expansion of late endosomes ( figure 1 , B). However, in cells expressing SNX10 and SNX11 at the same time, SNX10 and SNX11 co-localized on the same endosome structure. Such endosomes have both Rab5 (an early endosomal marker)...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More