Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fusion protein capable of targeting activation of RANK signal pathway and recombinant plasmid and application thereof

A technology of signaling pathways and fusion proteins, which is applied in the fields of fusion proteins targeting activating RANK signaling pathways and their recombinant plasmids and applications, can solve problems such as side effects, fatal hypercalcemia, systemic inflammatory reactions, etc., and achieve large Commercial value, the effect of avoiding side effects

Inactive Publication Date: 2014-01-29
JINAN UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, activating the RANK signaling pathway with RANK ligands often causes many side effects, such as severe osteoporosis, fatal hypercalcemia, systemic inflammatory response, etc.
[0003] Therefore, it is necessary to transform RANK so that it not only retains the function of RANK, but also overcomes its defects of causing side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein capable of targeting activation of RANK signal pathway and recombinant plasmid and application thereof
  • Fusion protein capable of targeting activation of RANK signal pathway and recombinant plasmid and application thereof
  • Fusion protein capable of targeting activation of RANK signal pathway and recombinant plasmid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] (1) Preparation of recombinant vector pENTR-2B-Gyrase B-HA

[0037] ① Obtain the Gyrase B gene by PCR reaction, and the primers (both 5'-3', synthesized by BGI) are as follows:

[0038] FP: CGGGATCCACCATGTACCCATACGATGTTCCAGATTACGCTATGTCGAACTCTTATGACTCCTCC

[0039] RP: CGGAATTCTTAGGTACCGCCTTCATAGTGGAAGTGGTCTTC.

[0040] Mix the PCR reaction solution according to the following system:

[0041]

[0042] The PCR reaction was performed according to the following procedures: initial denaturation at 94°C for 2 min; denaturation at 94°C for 15 sec, refolding at 55°C for 15 sec, extension at 68°C for 30 sec, 30 cycles; 72°C for 10 min.

[0043] ② Add 2.5 times the volume of frozen absolute ethanol to the PCR product obtained in step ① (add 0.1 times, 3M sodium acetate at pH 5.6 at the same time) to precipitate, and centrifuge to precipitate. The precipitate is formulated according to the following reaction system:

[0044]

[0045] The above reaction system was treated ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses fusion protein capable of targeting activation of a RANK signal pathway, a recombinant plasmid and an application thereof. The fusion protein has an amino acid sequence as shown in SEQ ID NO. 1, and is obtained by substituting a segment of a gyrase B sequence for a C terminal of a mouse RANK; the nucleotide sequence coding the fusion protein is shown in SEQ ID NO. 2. After the fusion protein is introduced into a cell, continuous stimulation of a micromolecular medicament of coumermycin is accepted, and a RANK-dependent signal pathway is targetedly activated; and thus side effect caused by disease treatment though ligand-activated RANK signal pathway using acceptors is prevented. A recombinant vector contains the nucleotide sequence shown in SEQ ID NO. 2. The recombinant vector has very important value for RANK function research and RANK-caused disease treatment research.

Description

technical field [0001] The invention relates to the construction of a fusion protein, in particular to a fusion protein capable of targeting and activating the RANK signaling pathway, its recombinant plasmid and its application. Background technique [0002] The receptor activator of nuclear factor-κB (RANK) signaling pathway has multiple physiological functions. This signaling pathway is essential for tooth formation, lymph node formation, and osteoclast formation; the synergistic effect of RANK and CD40 signaling pathways can guide the formation of thymic medulla microstructure to control the body's central immune tolerance; RANK signaling pathway regulation Fever center; RANK signaling pathway can promote the survival and activity of dendritic cells; RANK signaling pathway is essential for the formation of mammary epithelial cells; RANK signaling pathway plays an important role in the generation of vascular endothelial cells and the formation of blood vessels; The RANK s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/14C12N15/62C12N15/63C12N15/867C12N15/66C12Q1/02
Inventor 秦俊文谢琪璇蔡冬青万颖黄卉卉秋山泰身井上纯一郎禹艳红齐绪峰武征
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com