Method for quickly identifying pseudo-ginseng

A Panax notoginseng and fast technology, applied in the field of identification of Panax notoginseng with specific SNPs, can solve the problems of identification obstacles, difficulties in identification of Panax notoginseng and its related species, high price of Panax notoginseng medicinal materials, etc., to achieve wide applicability and accurate identification. Effect

Inactive Publication Date: 2013-01-23
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Panax notoginseng medicinal materials are expensive, and counterfeit products often appear in the market
Due to the similar appearance of Panax notoginseng and its related species and counterfeit products, traditional character identification has certain difficulties in the identification of Panax notoginseng and its close relatives, especially for the identification of Panax notoginseng slices, powder, seeds and seedlings that exist in the medicinal material market. bigger obstacle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly identifying pseudo-ginseng
  • Method for quickly identifying pseudo-ginseng
  • Method for quickly identifying pseudo-ginseng

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 10

[0024] The identification method of embodiment 1 Panax notoginseng medical material raw material

[0025] 1) 24 samples of Panax notoginseng collected from different medicinal material stores and genuine localities (Yunnan), each took 20 mg of medicinal material, and ground them on a MM400 ball mill (Retsch, Germany), and used plants from Tiangen Biochemical Technology (Beijing) Co., Ltd. Genomic DNA kit to extract total DNA.

[0026] Table 1 Panax notoginseng sample information table

[0027]

[0028]

[0029] 2) PCR amplification

[0030] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; ITS3R: GACGCTTCTCCAGACTACAAT, synthesized by Sangon Bioengineering Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2 μmol / μL.

[0031] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 1 μL (-about 30 ng) of template DNA, 1.0 U of Taq DNA polymerase, add st...

Embodiment 2 10

[0043] Identification of embodiment 2 notoginseng decoction pieces

[0044] It is basically the same as Example 1, except that notoginseng decoction pieces are used as samples, DNA is extracted and identified, and as a result, the above two SNP sites can also be specifically detected. And the sequence comparison found that the 140th position of the ITS2 intergenic region sequence (SEQ ID No.1) of the Sanqi decoction piece DNA is T, and the 207th position is T.

Embodiment 3 10

[0045] The identification of embodiment 3 Panax notoginseng powder

[0046] Basically the same as Example 1, the difference is that notoginseng powder is used as a sample, DNA is extracted and identified, and the results can also specifically detect the above two SNP sites, and the sequence comparison shows that the ITS2 of the notoginseng powder DNA The 140th position of the intergenic region sequence (SEQ ID No.1) is T, and the 207th position is T.

[0047] SEQ ID No.1 in the sequence listing of the present invention is the consensus sequence of P. notoginseng.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly identifying pseudo-ginseng. The method comprises steps as follows: 1) getting DNA (Deoxyribose Nucleic Acid) of a sample to be detected as a template, and amplifying the fragments containing the sequences shown as SEQ ID No.1 (Sequence Identification Number); and 2) sequencing the amplified products, analyzing the sequences as shown in SEQ ID No.1; if the bit 140 beginning from 5' end in the sequences as shown in SEQ ID No.1 is T or the bit 207 is T, identifying that the sample is pseudo-ginseng; and if the bit 140 and the bit 207 beginning from the 5' end in the sequence as shown in SEQ ID No.1 are not T, identifying that the sample is not pseudo-ginseng. With the adoption of the method disclosed by the invention, the raw pseudo-ginseng, the sibling species of the raw pseudo-ginseng, the crude medicine, the raw medicinal slices, the powder and the adulterant can be quickly and accurately identified.

Description

technical field [0001] The invention refers to the technical field of identifying varieties of Chinese medicinal materials, and specifically relates to a method for identifying Panax notoginseng with specific SNPs. Background technique [0002] Sanqi (Panax notoginseng (Burk.) F.H.Chen) is a perennial plant of the genus Ginseng, which is a traditional Chinese medicinal material in my country and contains a variety of biologically active components. Radix Notoginseng is a precious Chinese medicinal material, which has the effects of dispelling blood stasis, stopping bleeding, reducing swelling and relieving pain. It can treat various hemorrhagic diseases, ginseng is "the first to replenish qi", and Panax notoginseng is "the first to replenish blood". Panax ginseng (Panax ginseng C.A.Mey), American ginseng (Panax quinquefolium L.), bamboo ginseng (Panax japonicus C.A.Mey.) and its variant Panax japonicus C.A.Mey.var.angustifius (Burk)Cheng et Chu), Panax japonicus C.A.Mey.va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor廖保生韩建萍陈晓辰陈士林
OwnerINST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI