Marine fish mitochondrion 12S rRNA (ribosomal ribonucleic acid) gene amplification primer and design and amplification method thereof
A gene amplification and mitochondrial technology, applied in biochemical equipment and methods, DNA/RNA fragments, DNA preparation, etc., can solve the problems of different amplification capabilities of design methods, and achieve the goal of promoting forward development, strong amplification capabilities, and wide-ranging The effect of expanding the range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] 1. Design and synthesis of primers for the amplification of mitochondrial 12S rRNA gene in marine fish:
[0029] Log in to the GenBank database on the NCBI website to search for the tRNA-Phe and 16S rRNA gene sequences of the mitochondrial genomes of marine fishes that have been determined, load the sequences into the analysis software MEGA5.0, and use the ClustalW algorithm for multiple sequence alignment analysis , find the conserved sequence, load the found conserved sequence into the Premier Primer5.0 software and design the marine fish mitochondrial 12S rRNA gene amplification in the manual design mode (that is, select Low under the manual option, and the specific parameters are the default settings) Primers: Among them, the light chain primer Marinefish-12SrRNA-F (shown in SEQ ID No.1) has 22 bases: ACTAAAGCATAACACTGAAGAT, located on the tRNA-Phe gene; the heavy chain primer Marinefish-12SrRNA-R (shown in SEQ ID No.2 Shown) has 22 bases: TTCATTTTCTCTTTCAGCTTTCC, l...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap