Marine fish mitochondrion 12S rRNA (ribosomal ribonucleic acid) gene amplification primer and design and amplification method thereof

A gene amplification and mitochondrial technology, applied in biochemical equipment and methods, DNA/RNA fragments, DNA preparation, etc., can solve the problems of different amplification capabilities of design methods, and achieve the goal of promoting forward development, strong amplification capabilities, and wide-ranging The effect of expanding the range

Inactive Publication Date: 2013-02-06
ZHEJIANG OCEAN UNIV
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the selection of the design template sequence, the different design methods, and the limitation of the amplification ability of the universal primer itself, the use of the reported universal primers to amplify a variety of marine fishes, mainly gobies and cichlids, exists Therefore, it is necessary to design new universal primers for fish mitochondrial 12S rRNA gene, which are complementary to the reported primers, to effectively obtain the vast majority of fish mitochondrial 12S rRNA gene sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marine fish mitochondrion 12S rRNA (ribosomal ribonucleic acid) gene amplification primer and design and amplification method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Design and synthesis of primers for the amplification of mitochondrial 12S rRNA gene in marine fish:

[0029] Log in to the GenBank database on the NCBI website to search for the tRNA-Phe and 16S rRNA gene sequences of the mitochondrial genomes of marine fishes that have been determined, load the sequences into the analysis software MEGA5.0, and use the ClustalW algorithm for multiple sequence alignment analysis , find the conserved sequence, load the found conserved sequence into the Premier Primer5.0 software and design the marine fish mitochondrial 12S rRNA gene amplification in the manual design mode (that is, select Low under the manual option, and the specific parameters are the default settings) Primers: Among them, the light chain primer Marinefish-12SrRNA-F (shown in SEQ ID No.1) has 22 bases: ACTAAAGCATAACACTGAAGAT, located on the tRNA-Phe gene; the heavy chain primer Marinefish-12SrRNA-R (shown in SEQ ID No.2 Shown) has 22 bases: TTCATTTTCTCTTTCAGCTTTCC, l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of marine fish mitochondrial genome research, and particularly relates to a marine fish mitochondrion 12S rRNA (ribosomal ribonucleic acid) gene amplification primer. The primer is composed of two single-chain oligonucleotide chains, wherein a light chain primer is a nucleotide sequence shown as SEQ ID NO.1, and a heavy chain primer is a nucleotide sequence shown as SEQ ID NO.2. The invention also provides a design method of the amplification primer and a method for amplifying a marine fish DNA (deoxyribonucleic acid) solution by using the amplification primer. The invention can efficiently and specifically amplify multiple marine fish mitochondrion 12S rRNA genes and can be used for the analytical study on the system evolution of different taxonomic categories of fishes, thereby providing a powerful tool for fish species identification, germplasm resource survey and system evolution research.

Description

technical field [0001] The invention belongs to the research field of mitochondrial genomes of marine fishes, and in particular relates to a primer for efficiently amplifying mitochondrial 12S rRNA genes of various marine fishes and a design and amplification method thereof. Background technique [0002] Fish mitochondrial DNA (Mitochondrial DNA, mtDNA) is a covalently closed circular structure, including a light chain and a heavy chain, and is a relatively independent replication unit outside the nucleus. Compared with nuclear DNA, fish mitochondrial DNA has the characteristics of large copy number, simple molecular structure, high coding efficiency, fast evolution rate, maternal inheritance and different evolution rates in different regions. Due to these characteristics of fish mitochondrial DNA, it has become an important molecular marker in the research fields of fish molecular population genetics, phylogeny and conservation biology. Similar to other vertebrates, fish m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
Inventor徐田军孙悦娜王日昕金逍逍
OwnerZHEJIANG OCEAN UNIV