Fluorogenic quantitative polymerase chain reaction (PCR) detection assay kit for complementary deoxyribonucleic acid (cDNA) sequence of mouse beta-actin
A detection kit and fluorescence quantitative technology, applied in the field of detection kits and fluorescence quantitative PCR detection kits, can solve the problems of narrow detection linear range, low sensitivity and poor specificity, and achieve wide detection linear range, high sensitivity and specificity. strong effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Construction and identification of embodiment 1 plasmid standard
[0041] 1.1 Construction of plasmid standard
[0042] A 126bp gene fragment (5' CCGATGCCCTGAGGCTCTTTTCCAGCCTTCCTTCTTGGGTATGGAATCCTGTGGCATCCATGAAACTACATTCAATTCCATCATGAAGTGTGACGTTGACATCCGTAAAGACCCTCTATGCCAACAC3') was inserted into the Sam I restriction site of pUC57 plasmid (purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.). The plasmid standard was successfully constructed, and the schematic diagram of the pUC57 plasmid is shown infigure 1 .
[0043] 1.2 Sequencing identification
[0044] The plasmid pUC57 was digested, and the sequence of the digested product was determined, and the plasmid standard was successfully constructed.
Embodiment 2
[0045] Design and preparation of embodiment 2 specific primers and probes
[0046] 2.1 Design of specific primers and probes
[0047] The cDNA sequence of β-actin (GeneID: 218370) was obtained from the NCBI gene bank by Blast method, and a pair of specific primers and a probe were obtained after screening based on this template:
[0048] Upstream primer (FP): 5'CCTGAGGCTCTTTTCCAGCC3' (SEQ ID No.1),
[0049] Downstream primer (RP): 5'TAGAGGTCTTTACGGATGTCAACGT3' (SEQ ID No. 2),
[0050] Probe: 5'TCCTTCTTGGGTATGGAATCCTGTGGC3' (SEQ ID NO. 3).
[0051] The reporter group at the 5' end of the probe was labeled with FAM, and the quencher group at the 3' end was labeled with TAMRA; the length of the amplified product was 109bp. Both primers and probes were prepared as 100 μmol / L stock solution and diluted 10 times with sterile water for injection before use.
[0052] 2.2 Specific identification of the specific primer pair (SEQ ID No.1 and SEQ ID No.2) on the plasmid standard
[0...
experiment example 3
[0059] Experimental example 3 specificity experiment of fluorescent quantitative PCR kit of the present invention
[0060] The mouse genome (genome) was used as the positive amplification object, and the irrelevant virus HSV (virustemplate) and no template control (NTC) were used as negative controls, and the designed primers were used for melting curve analysis to verify the specificity.
[0061] For specific results, see Figure 4 . The experimental results show that the specific primers of this kit have a single product peak for the mouse genome, and the two negative controls have no amplified product peaks, and even no primer dimer peaks. The experimental results show that the primers of this kit are specific. strong.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More