Strain for producing high-yield DL-alanine and application thereof
A technology of alanine and alanine racemase, applied in bacteria, microorganisms, recombinant DNA technology, etc., can solve the problem of lack of efficient production of alanine racemase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0086] The expression strain provided by the invention can be efficiently applied to the production of DL-alanine. In a preferred example of the present invention, the preparation method of said DL-alanine comprises steps:
[0087] Transform raw material L-alanine with the bacterial strain provided by the invention to obtain DL-alanine;
[0088] Alternatively, the method comprises: converting the raw material L-alanine with the fermentation broth of the bacterial strain provided by the present invention to obtain DL-alanine. Wherein, the fermented liquid is a fermented liquid containing bacteria.
[0089] In another preferred example, the method includes: cultivating the bacterial strain described in the present invention in the presence of L-alanine.
[0090] In another preferred example, the conversion rate of the L-alanine is ≥95%, preferably ≥98%, more preferably ≥99%.
[0091] In another preferred example, the dosage of the strain is 0.5-5 g / l, preferably 1-3 g / l.
[...
Embodiment 1
[0118] Example 1 Construction of Bacillus subtilis-derived D-alanine racemase expression strain
[0119] Bacillus subtilis subsp.subtilis str.168 was inoculated in LB liquid medium, and cultured at 220 rpm at 30°C for 24 hours. For the extraction of total DNA, refer to the instructions of the genome extraction kit.
[0120] According to the reported gene sequence of D-alanine racemase gene dal derived from Bacillus subtilis subsp.subtilis str.168 (NCBI accession number: AL009126.3), a sense primer and an antisense primer were synthesized. The nucleotide sequences of the primers are respectively recorded in SEQ ID NO: 1 (dal-NdeI-F) and SEQ ID NO: 2 (dal-BamHI-R).
[0121] SEQ ID NO: 1dal-NdeI-F
[0122] GGAATTCCATATGAGCACAAAACCTTTTTAC
[0123] SEQ ID NO: 2dal-BamHI-R
[0124] CGGGATCCTTAATTGCTTATATTTACCT
[0125] The reaction solution was subjected to PCR amplification, and 50 μL of the reaction solution contained the above-mentioned pair of primers, wherein each primer was...
Embodiment 2
[0128] Example 2 Construction of alanine racemase expression strain derived from Pseudomonas putida KT2440
[0129] The alanine racemase gene alr (NCBI accession number: NC_002947) derived from Pseudomonas putida KT2440 was synthesized to obtain the recombinant plasmid pUC57-alr.
[0130] Digest pUC57-alr with NdeI and BamHI at 37°C for 3-6 hours. The enzyme digestion system is: pUC57-alr38μL, 10X Buffer Tango10μL, NdeI1μL, BamHI1μL, nucleic acid electrophoresis and gel recovery kit to recover the 1.2kb alr fragment.
[0131] The recovered alr fragment was ligated with the expression vector pET24a treated by the same enzyme digestion with T4 DNA ligase overnight at 16°C, transformed into Escherichia coli DH5α competent cells with calcium chloride method, spread on LB plates containing Kan, and cultured overnight at 37°C . Pick a single clone and inoculate it in an LB test tube for culture, extract the plasmid with a plasmid extraction kit, and verify it by double enzyme diges...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com