Strain for producing high-yield DL-alanine and application thereof

A technology of alanine and alanine racemase, applied in bacteria, microorganisms, recombinant DNA technology, etc., can solve the problem of lack of efficient production of alanine racemase

Active Publication Date: 2013-09-04
ANHUI HUAHENG BIOTECH
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still a lack of methods in the art that can efficiently produce alanine racemase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strain for producing high-yield DL-alanine and application thereof
  • Strain for producing high-yield DL-alanine and application thereof
  • Strain for producing high-yield DL-alanine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0086] The expression strain provided by the invention can be efficiently applied to the production of DL-alanine. In a preferred example of the present invention, the preparation method of said DL-alanine comprises steps:

[0087] Transform raw material L-alanine with the bacterial strain provided by the invention to obtain DL-alanine;

[0088] Alternatively, the method comprises: converting the raw material L-alanine with the fermentation broth of the bacterial strain provided by the present invention to obtain DL-alanine. Wherein, the fermented liquid is a fermented liquid containing bacteria.

[0089] In another preferred example, the method includes: cultivating the bacterial strain described in the present invention in the presence of L-alanine.

[0090] In another preferred example, the conversion rate of the L-alanine is ≥95%, preferably ≥98%, more preferably ≥99%.

[0091] In another preferred example, the dosage of the strain is 0.5-5 g / l, preferably 1-3 g / l.

[...

Embodiment 1

[0118] Example 1 Construction of Bacillus subtilis-derived D-alanine racemase expression strain

[0119] Bacillus subtilis subsp.subtilis str.168 was inoculated in LB liquid medium, and cultured at 220 rpm at 30°C for 24 hours. For the extraction of total DNA, refer to the instructions of the genome extraction kit.

[0120] According to the reported gene sequence of D-alanine racemase gene dal derived from Bacillus subtilis subsp.subtilis str.168 (NCBI accession number: AL009126.3), a sense primer and an antisense primer were synthesized. The nucleotide sequences of the primers are respectively recorded in SEQ ID NO: 1 (dal-NdeI-F) and SEQ ID NO: 2 (dal-BamHI-R).

[0121] SEQ ID NO: 1dal-NdeI-F

[0122] GGAATTCCATATGAGCACAAAACCTTTTTAC

[0123] SEQ ID NO: 2dal-BamHI-R

[0124] CGGGATCCTTAATTGCTTATATTTACCT

[0125] The reaction solution was subjected to PCR amplification, and 50 μL of the reaction solution contained the above-mentioned pair of primers, wherein each primer was...

Embodiment 2

[0128] Example 2 Construction of alanine racemase expression strain derived from Pseudomonas putida KT2440

[0129] The alanine racemase gene alr (NCBI accession number: NC_002947) derived from Pseudomonas putida KT2440 was synthesized to obtain the recombinant plasmid pUC57-alr.

[0130] Digest pUC57-alr with NdeI and BamHI at 37°C for 3-6 hours. The enzyme digestion system is: pUC57-alr38μL, 10X Buffer Tango10μL, NdeI1μL, BamHI1μL, nucleic acid electrophoresis and gel recovery kit to recover the 1.2kb alr fragment.

[0131] The recovered alr fragment was ligated with the expression vector pET24a treated by the same enzyme digestion with T4 DNA ligase overnight at 16°C, transformed into Escherichia coli DH5α competent cells with calcium chloride method, spread on LB plates containing Kan, and cultured overnight at 37°C . Pick a single clone and inoculate it in an LB test tube for culture, extract the plasmid with a plasmid extraction kit, and verify it by double enzyme diges...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a strain for producing high-yield DL-alanine and an application thereof, and particularly provides an engineering strain for producing D-alanine racemase. The strain is esherichia coli and carries an expression vector for expressing Bacillus subtilis D-alanine racemase. The expression strain can be effectively used for producing the DL-alanine at a low cost, and has a higher application value.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the present invention relates to a strain expressing D-alanine racemase derived from Bacillus subtilis. Background technique [0002] DL-alanine, the chemical name is DL-α-aminopropionic acid (abbreviated as alanine), the molecular formula is CH3CH(NH2)COOH, the molecular weight is 89.09, colorless to white odorless needle crystal or crystalline powder, sweet Taste, soluble in water, slightly soluble in ethanol, insoluble in ether and acetone, no optical activity. DL-alanine is mainly used as a food additive, but also an important pharmaceutical intermediate. It has been widely used in the food industry in foreign countries, with a large annual demand and rapid growth. Its main producer is Japan, and its main producers include Musashino Chemical Co., Ltd. and Ajinomoto. [0003] [0004] The existing DL-alanine production processes mainly include chemical synthesis method, biologi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12P13/06C12R1/125
Inventor陶荣盛朱傅赟沈正权沈青潘振华孙梁栋陈成郑云徐明杨晟
OwnerANHUI HUAHENG BIOTECH