High-yield dl-alanine production strain and its application

A technology of alanine and alanine racemase, applied in the direction of bacteria, microorganisms, recombinant DNA technology, etc., can solve the problem of lack of efficient production of alanine racemase

Active Publication Date: 2015-08-26
ANHUI HUAHENG BIOTECH
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still a lack of methods in the art that can efficiently produce alanine racemase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield dl-alanine production strain and its application
  • High-yield dl-alanine production strain and its application
  • High-yield dl-alanine production strain and its application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0086] The expression strain provided by the present invention can be efficiently applied to the production of DL-alanine. In a preferred embodiment of the present invention, the preparation method of DL-alanine includes the steps:

[0087] Use the strain provided by the invention to transform the raw material L-alanine to obtain DL-alanine;

[0088] Or the method includes: using the fermentation broth of the strain provided in the present invention to transform the raw material L-alanine to obtain DL-alanine. Wherein, the fermentation broth is a fermentation broth containing bacteria.

[0089] In another preferred embodiment, the method includes: culturing the strain of the present invention in the presence of L-alanine.

[0090] In another preferred embodiment, the conversion rate of L-alanine is ≥95%, preferably ≥98%, and more preferably ≥99%.

[0091] In another preferred example, the amount of the strain is 0.5-5 g / l, preferably 1-3 g / l.

[0092] In another preferred example, the ...

Embodiment 1

[0118] Example 1 Construction of strain expressing D-alanine racemase from Bacillus subtilis

[0119] Bacillus subtilis subsp. subtilis str. 168 was inoculated into LB liquid medium and cultured at 30°C at 220 rpm for 24 hours. The extraction of total DNA refers to the instructions of the genome extraction kit.

[0120] According to the reported gene sequence of the D-alanine racemase gene dal from Bacillus subtilis subsp.subtilis str.168 (NCBI accession number: AL009126.3), the sense primer and the antisense primer were synthesized. The nucleotide sequences of the primers are recorded in SEQ ID NO: 1 (dal-NdeI-F) and SEQ ID NO: 2 (dal-BamHI-R), respectively.

[0121] SEQ ID NO: 1dal-NdeI-F

[0122] GGAATTCCATATGAGCACAAAACCTTTTTAC

[0123] SEQ ID NO: 2dal-BamHI-R

[0124] CGGGATCCTTAATTGCTTATATTTACCT

[0125] Perform PCR amplification on the reaction solution. 50μL of the reaction solution contains the above-mentioned pair of primers. Each primer is 50pmol, 0.2mM dNTP, 100ng total DNA t...

Embodiment 2

[0128] Example 2 Construction of alanine racemase-expressing strains derived from Pseudomonas putida KT2440

[0129] The alanine racemase gene alr (NCBI accession number: NC_002947) derived from Pseudomonas putida KT2440 was fully synthesized to obtain the recombinant plasmid pUC57-alr.

[0130] The pUC57-alr was double digested with NdeI and BamHI at 37°C for 3-6 hours. The digestion system was: pUC57-alr 38 μL, 10X Buffer Tango 10 μL, NdeI 1 μL, BamHI 1 μL, nucleic acid electrophoresis, and a gel recovery kit to recover 1.2 kb alr fragments.

[0131] The recovered alr fragment was ligated with the expression vector pET24a treated with the same restriction enzyme digestion treatment with T4DNA ligase overnight at 16°C, transformed into E. coli DH5α competent cells by the calcium chloride method, spread on LB plates containing Kan, and cultured overnight at 37°C . Pick a single clone and inoculate it in an LB test tube for culture. Use a plasmid extraction kit to extract the plasmid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a strain for producing high-yield DL-alanine and an application thereof, and particularly provides an engineering strain for producing D-alanine racemase. The strain is esherichia coli and carries an expression vector for expressing Bacillus subtilis D-alanine racemase. The expression strain can be effectively used for producing the DL-alanine at a low cost, and has a higher application value.

Description

Technical field [0001] The invention belongs to the field of biotechnology. Specifically, the present invention relates to a strain expressing D-alanine racemase derived from Bacillus subtilis. Background technique [0002] DL-alanine, chemical name is DL-α-alanine (alanine for short), molecular formula is CH3CH(NH2)COOH, molecular weight is 89.09, colorless to white odorless needle crystal or crystalline powder, sweet Taste, easily soluble in water, slightly soluble in ethanol, insoluble in ether and acetone, without optical rotation. DL-alanine is mainly used as a food additive, and it is also an important pharmaceutical intermediate. It has been widely used in the food industry abroad, and its annual demand is large and growing rapidly. Its main production country is Japan, and the main production companies are Musashino Chemical Co., Ltd. and Ajinomoto. [0003] [0004] The existing DL-alanine production processes mainly include chemical synthesis, biological fermentation a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/75C12P13/06C12R1/125
Inventor陶荣盛朱傅赟沈正权沈青潘振华孙梁栋陈成郑云徐明杨晟
OwnerANHUI HUAHENG BIOTECH