Applications of demethoxyviridin in preparing Amyloid-beta aggregation inhibitor
A technology of amyloid protein and green glue enzyme, which is applied in the direction of medical preparations containing active ingredients, organic active ingredients, nervous system diseases, etc., and can solve the problem of high toxicity of aggregates
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] The Nodulisporium fungus 65-12-7-1 was isolated from the lichen of the genus Nodulisporium collected from Zixi Mountain, Yunnan, China. It was identified as Nodulisporium sp. by taxonomic research. Its 18S rRNA gene The GenBank accession number of the sequence is KC894854, and its sequence is:
[0025] TCATTACAGAGTTACCTAAACTCCCAAACCCTTTGTGAACCTTACCACCGTTTCCTCGGCGCGAGCTGCGGCTACCCGGGAGCTACCCTGCAGCTACCCTGCAGTAGGGGGGCCTACCCTGTAGCCGGCCGACGGCCCGCCGAAGGACCGCTAAACTCTTGTTTGAACCACTGTATCTCTGAACACCTAACTGAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTATTCGAGCGTCATTTCGACCCCTTAAGCCCCTGTTGCTTAGCGTTGGGACTCTGCGCCTCAGGGCGCAGTTCCCGAAAGTTAGTGGCGGAGTTAGGGTACACTCTCAGCGTAGTAATCTCTTCTCGCTCGTGTGGTGGCCCTGGCTGCTGGCCGTTAAACACCCCCCCGCCCCCGCGCGGACAAGTGGTGACCTC。
[0026] The strain was preserved on March 29, 2013 in the General Microbiology Center of China Committee for the Collection of Microbial ...
Embodiment 2
[0027] Embodiment 2: Arthrosporum fungus 65-12-7-1 mass fermentation and sample pretreatment method thereof
[0028] Polyarthrospora fungus 65-12-7-1 was activated on a slant, inoculated in PDB medium, 25°C, 220r min -1 Shake culture for 5 days, inoculate into 1400g (70g×20) rice medium according to 7% inoculum amount, and culture at 25°C for 48 days to obtain a fermented product. Add 2 times the volume of ethyl acetate to continuously soak and extract the fermented product, filter the extract (repeat 3 times), and concentrate the extract to dryness to obtain a crude extract. The composition ratio of the rice medium: 70g of rice, 105mL of distilled water. The PDB medium is composed of the following components in weight to volume ratio: potatoes 200g / L, glucose 20g / L, and purified water 1L.
Embodiment 3
[0029] Embodiment 3: compound is separated
[0030]The total extract of the fermentation product of the strain was suspended with 10 times the amount (M / V) of 90% by volume methanol / water, and then extracted with an equal volume of cyclohexane to obtain the cyclohexane extraction site (C) and methanol / water Water layer part (W). Further separate the methanol / water layer, use ODS medium and low pressure column chromatography, and sequentially elute with water-methanol at volume ratios of 70:30, 50:50, 30:70, and 0:100 to obtain the fraction 65-12- 7-1W-1, 65-12-7-1W-2, 65-12-7-1W-3 and 65-12-7-1W-4; for the elution with volume ratio 70:30 water-methanol Fraction 65-12-7-1W-3 was subjected to ODS medium and low pressure column chromatography, and was eluted with water-methanol at volume ratios of 80:20, 60:40, 50:50, and 0:100 in sequence, and each ratio was eluted by 5 column volumes to obtain subfractions 65-12-7-1W3a (partially eluted with a volume ratio of 80:20 water-meth...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap