Applications of demethoxyviridin in preparing Amyloid-beta aggregation inhibitor

A technology of amyloid protein and green glue enzyme, which is applied in the direction of medical preparations containing active ingredients, organic active ingredients, nervous system diseases, etc., and can solve the problem of high toxicity of aggregates

Inactive Publication Date: 2013-09-25
JINAN UNIVERSITY
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although Aβ 42 Not much in the human body, only Aβ 40 1 / 99 of Aβ 42 Due to spontaneous aggregation, its aggregates are more toxic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of demethoxyviridin in preparing Amyloid-beta aggregation inhibitor
  • Applications of demethoxyviridin in preparing Amyloid-beta aggregation inhibitor
  • Applications of demethoxyviridin in preparing Amyloid-beta aggregation inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The Nodulisporium fungus 65-12-7-1 was isolated from the lichen of the genus Nodulisporium collected from Zixi Mountain, Yunnan, China. It was identified as Nodulisporium sp. by taxonomic research. Its 18S rRNA gene The GenBank accession number of the sequence is KC894854, and its sequence is:

[0025] TCATTACAGAGTTACCTAAACTCCCAAACCCTTTGTGAACCTTACCACCGTTTCCTCGGCGCGAGCTGCGGCTACCCGGGAGCTACCCTGCAGCTACCCTGCAGTAGGGGGGCCTACCCTGTAGCCGGCCGACGGCCCGCCGAAGGACCGCTAAACTCTTGTTTGAACCACTGTATCTCTGAACACCTAACTGAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTATTCGAGCGTCATTTCGACCCCTTAAGCCCCTGTTGCTTAGCGTTGGGACTCTGCGCCTCAGGGCGCAGTTCCCGAAAGTTAGTGGCGGAGTTAGGGTACACTCTCAGCGTAGTAATCTCTTCTCGCTCGTGTGGTGGCCCTGGCTGCTGGCCGTTAAACACCCCCCCGCCCCCGCGCGGACAAGTGGTGACCTC。

[0026] The strain was preserved on March 29, 2013 in the General Microbiology Center of China Committee for the Collection of Microbial ...

Embodiment 2

[0027] Embodiment 2: Arthrosporum fungus 65-12-7-1 mass fermentation and sample pretreatment method thereof

[0028] Polyarthrospora fungus 65-12-7-1 was activated on a slant, inoculated in PDB medium, 25°C, 220r min -1 Shake culture for 5 days, inoculate into 1400g (70g×20) rice medium according to 7% inoculum amount, and culture at 25°C for 48 days to obtain a fermented product. Add 2 times the volume of ethyl acetate to continuously soak and extract the fermented product, filter the extract (repeat 3 times), and concentrate the extract to dryness to obtain a crude extract. The composition ratio of the rice medium: 70g of rice, 105mL of distilled water. The PDB medium is composed of the following components in weight to volume ratio: potatoes 200g / L, glucose 20g / L, and purified water 1L.

Embodiment 3

[0029] Embodiment 3: compound is separated

[0030]The total extract of the fermentation product of the strain was suspended with 10 times the amount (M / V) of 90% by volume methanol / water, and then extracted with an equal volume of cyclohexane to obtain the cyclohexane extraction site (C) and methanol / water Water layer part (W). Further separate the methanol / water layer, use ODS medium and low pressure column chromatography, and sequentially elute with water-methanol at volume ratios of 70:30, 50:50, 30:70, and 0:100 to obtain the fraction 65-12- 7-1W-1, 65-12-7-1W-2, 65-12-7-1W-3 and 65-12-7-1W-4; for the elution with volume ratio 70:30 water-methanol Fraction 65-12-7-1W-3 was subjected to ODS medium and low pressure column chromatography, and was eluted with water-methanol at volume ratios of 80:20, 60:40, 50:50, and 0:100 in sequence, and each ratio was eluted by 5 column volumes to obtain subfractions 65-12-7-1W3a (partially eluted with a volume ratio of 80:20 water-meth...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of microbial medicine, and discloses applications of demethoxyviridin, a steroid compound, in preparing an Amyloid-beta aggregation inhibitor. The Amyloid-beta aggregation inhibitor is used for preparing medicament for treating Alzheimer's disease. The demethoxyviridin is obtained by fermenting and separating Nodulisporium sp. 65-12-7-1.

Description

technical field [0001] The invention belongs to the field of microbial medicine, and in particular relates to the use of a steroid compound demethoxyviridin in the preparation of a beta-amyloid protein (Amyloid-beta, Abeta) aggregation inhibitor. Background technique [0002] Alzheimer's disease is a kind of central nervous system degenerative disease syndrome caused by brain diseases, characterized by progressive cognitive dysfunction and memory impairment, which manifests as intelligence (including memory, learning ability, direction recognition ability, language ability, comprehension, and judgment). Alzheimer's disease (Alzheimer's disease, AD), vascular dementia (VA), Lewy body dementia (Dementia with Lewy bodies, DLB) and frontotemporal dementia (Frontotemporal dementia, FTD) ) and other 4 types. Among all dementia patients, Alzheimer's disease patients account for 50-70%, which is the most common type of senile dementia. [0003] Drugs currently on the market for t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/58A61P25/28
Inventor 高昊姚新生郑易之郭良栋陈国栋孙翔郑启昌孔明珠李小霞
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap